KCNN2 (NM_021614) Human 3' UTR Clone

CAT#: SC204183

3' UTR clone of potassium intermediate/small conductance calcium-activated channel subfamily N member 2 (KCNN2) transcript variant 1 for miRNA target validation


Reconstitution Protocol

USD 683.00

4 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

USD 188.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00

Other products for "KCNN2"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol KCNN2
Synonyms hSK2; KCa2.2; SK2; SKCA2; SKCa 2
ACCN NM_021614
Insert Size 344 bp
Sequence Data
>SC204183 3’UTR clone of NM_021614
The sequence shown below is from the reference sequence of NM_021614. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GCACCACCAACTTCATCAGAGAGTAGCTAGAAGAGAATAAGTTAACCACAAAATAAGACTTTTTGCCAT
CATATGGTCAATATTTTAGCTTTTATTGTAAAGCCCCTATGGTTCTAATCAGCGTTATCCGGGTTCTGA
TGTCAGAATCCTGGGAACCTGAACACTAAGTTTTAGGCCAAAATGAGTGAAAACTCTTTTTTTTTCTTT
CAGATGCACAGGGAATGCACCTATTATTGCTATATAGATTGTTCCTCCTGTAATTTCACTAACTTTTTA
TTCATGCACTTCAAACAAACTTTACTACTACATTATATGATATATAATAAAAAAAGTTAATTTCTGCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_021614.4
Summary Action potentials in vertebrate neurons are followed by an afterhyperpolarization (AHP) that may persist for several seconds and may have profound consequences for the firing pattern of the neuron. Each component of the AHP is kinetically distinct and is mediated by different calcium-activated potassium channels. The protein encoded by this gene is activated before membrane hyperpolarization and is thought to regulate neuronal excitability by contributing to the slow component of synaptic AHP. This gene is a member of the KCNN family of potassium channel genes. The encoded protein is an integral membrane protein that forms a voltage-independent calcium-activated channel with three other calmodulin-binding subunits. Alternate splicing of this gene results in multiple transcript variants. [provided by RefSeq, May 2013]
Locus ID 3781
MW 13.5

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.