COASY (NM_001042531) Human 3' UTR Clone

CAT#: SC204048

3' UTR clone of Coenzyme A synthase (COASY) nuclear gene encoding mitochondrial protein transcript variant 5 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: COASY
• Synonyms: DPCK; FLJ35179; NBP; pOV-2; PPAT; UKR1
• ACCN: NM_001042531
• Insert Size: 339 bp
• Sequence Data:
  Insert Sequence

  >SC204048 3’UTR clone of NM_001042531
  The sequence shown below is from the reference sequence of NM_001042531. The complete sequence of this clone may contain minor differences, such as SNPs.
  Blue=Stop Codon Red=Cloning site
  
  GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
  TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
  ATTCCCAAGACTCATCAGGCCCTCGACTGAAAAGTTCTCAGTGGGGCCAGACTGGCTCCTGGAGCTGAC
  AAGCGACCCCGTGGTGAGGAGAAATGGGGGCCTTGATGCTCACCCTGGTTCAGGCCCAGAGGTCCAAGC
  TATACTGTGCAGGACATGGCCAGGCCTGGTGGACACAGGAAGCCTACCCAACACGCTGGTATTTGGCCA
  ACACTGAGGATGTGGTTCATGGGGGAGCAGTCCCCTCCCCACTCTTGCCCATGGGTGACTCTTACCCAC
  AGCTGACTAGGGCCAGCGCAAATACTGGAACCTGTAACAGAATTAAAGGTGAATGTTCTGAGA
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
  CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
  
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001042531.1
• Summary: Coenzyme A (CoA) functions as a carrier of acetyl and acyl groups in cells and thus plays an important role in numerous synthetic and degradative metabolic pathways in all organisms. In eukaryotes, CoA and its derivatives are also involved in membrane trafficking and signal transduction. This gene encodes the bifunctional protein coenzyme A synthase (CoAsy) which carries out the last two steps in the biosynthesis of CoA from pantothenic acid (vitamin B5). The phosphopantetheine adenylyltransferase domain of this bifunctional protein catalyzes the conversion of 4'-phosphopantetheine into dephospho-coenzyme A (dpCoA) while its dephospho-CoA kinase domain completes the final step by phosphorylating dpCoA to form CoA. Mutations in this gene are associated with neurodegeneration with brain iron accumulation (NBIA). Alternative splicing results in multiple isoforms. [provided by RefSeq, Apr 2014]
• Locus ID: 80347
• MW: 12.7