SERPING1 (NM_001032295) Human 3' UTR Clone

CAT#: SC203762

3' UTR clone of serpin peptidase inhibitor clade G (C1 inhibitor) member 1 (SERPING1) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: SERPING1
• Synonyms: C1IN; C1INH; C1NH; HAE1; HAE2
• ACCN: NM_001032295
• Insert Size: 297 bp
• Sequence Data:
  Insert Sequence

  >SC203762 3’UTR clone of NM_001032295
  The sequence shown below is from the reference sequence of NM_001032295. The complete sequence of this clone may contain minor differences, such as SNPs.
  Blue=Stop Codon Red=Cloning site
  
  GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
  TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
  ATGGGGCGAGTATATGACCCCAGGGCCTGAGACCTGCAGGATCAGGTTAGGGCGAGCGCTACCTCTCCA
  GCCTCAGCTCTCAGTTGCAGCCCTGCTGCTGCCTGCCTGGACTTGGCCCCTGCCACCTCCTGCCTCAGG
  TGTCCGCTATCCACCAAAAGGGCTCCCTGAGGGTCTGGGCAAGGGACCTGCTTCTATTAGCCCTTCTCC
  ATGGCCCTGCCATGCTCTCCAAACCACTTTTTGCAGCTTTCTCTAGTTCAAGTTCACCAGACTCTATAA
  ATAAAACCTGACAGACCATGA
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
  CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
  
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001032295.2
• Summary: This gene encodes a highly glycosylated plasma protein involved in the regulation of the complement cascade. Its encoded protein, C1 inhibitor, inhibits activated C1r and C1s of the first complement component and thus regulates complement activation. It is synthesized in the liver, and its deficiency is associated with hereditary angioneurotic oedema (HANE). Alternative splicing results in multiple transcript variants encoding the same isoform. [provided by RefSeq, May 2020]
• Locus ID: 710
• MW: 10.4