Syntaxin 4 (STX4) (NM_004604) Human 3' UTR Clone

CAT#: SC203673

3' UTR clone of syntaxin 4 (STX4) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: STX4
• Synonyms: p35-2; STX4A
• ACCN: NM_004604
• Insert Size: 298 bp
• Sequence Data:
  Insert Sequence

  >SC203673 3’UTR clone of NM_004604
  The sequence shown below is from the reference sequence of NM_004604. The complete sequence of this clone may contain minor differences, such as SNPs.
  Blue=Stop Codon Red=Cloning site
  
  GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
  TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
  GTCATCATTGGCGTCACAGTGGTTGGATAATGTCGCACATTGTTGGCACTAGGAGCACCAGGAACCCAG
  GGCCTGGCCTTCTCTCCCAGCAGCCTGGGGGGCAGGGCAGAGCCTCCAGTCGGACCCCTTCCTCACACT
  GGCCCCTATGCAGAAGGGCAGACAGTTCTTCTGGGGTTGGCAGCTGCTCATTCATGATGGCCTCCTCCT
  TCAGGCCTCAATGCCTGGGGGAGGCCTGCACTGTCCTGATTGGCCGGGACACACGGTTTTGTAAAAAAT
  TAAAAAACAAAAAAAGAGCATA
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
  CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
  
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_004604.5
• Summary: Plasma membrane t-SNARE that mediates docking of transport vesicles. Necessary for the translocation of SLC2A4 from intracellular vesicles to the plasma membrane. Together with STXB3 and VAMP2, may also play a role in docking/fusion of intracellular GLUT4-containing vesicles with the cell surface in adipocytes (By similarity). May also play a role in docking of synaptic vesicles at presynaptic active zones.[UniProtKB/Swiss-Prot Function]
• Locus ID: 6810
• MW: 10