C4BPA (NM_000715) Human 3' UTR Clone

CAT#: SC203382

3' UTR clone of complement component 4 binding protein alpha (C4BPA) for miRNA target validation


Reconstitution Protocol

USD 683.00

4 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

USD 188.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00

Other products for "C4BPA"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol C4BPA
Synonyms C4BP; PRP
ACCN NM_000715
Insert Size 285 bp
Sequence Data
>SC203382 3’UTR clone of NM_000715
The sequence shown below is from the reference sequence of NM_000715. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AGACAATCCACTTTGGATAAAGAACTATAATTTTTCTCAAAAGAAGGAGGAAAAGGTGTCTTGCTGGCT
TGCCTCTTGCAATTCAATACAGATCAGTTTAGCAAATCTACTGTCAATTTGGCAGTGATATTCATCATA
ATAAATATCTAGAAATGATAATTTGCTAAAGTTTAGTGCTTTGAGATTGTGAAATTATTAATCATCCTC
TGTGTGGCTCATGTTTTTGCTTTTCAACACACAAAGCACAAATTTTTTTTCGATTAAAAATGTATGTAT
AAAAAACTA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_000715.4
Summary This gene encodes a member of a superfamily of proteins composed predominantly of tandemly arrayed short consensus repeats of approximately 60 amino acids. Along with a single, unique beta-chain, seven identical alpha-chains encoded by this gene assemble into the predominant isoform of C4b-binding protein, a multimeric protein that controls activation of the complement cascade through the classical pathway. The genes encoding both alpha and beta chains are located adjacent to each other on human chromosome 1 in the regulator of complement activation gene cluster. Two pseudogenes of this gene are also found in the cluster. [provided by RefSeq, Jul 2008]
Locus ID 722
MW 11

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.