CYP2A7 (NM_030589) Human 3' UTR Clone

CAT#: SC203158

3' UTR clone of cytochrome P450 family 2 subfamily A polypeptide 7 (CYP2A7) transcript variant 2 for miRNA target validation


Reconstitution Protocol

USD 683.00

4 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

USD 188.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00

Other products for "CYP2A7"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol CYP2A7
Synonyms CPA7; CPAD; CYP2A; CYPIIA7; P450-IIA4
ACCN NM_030589
Insert Size 284 bp
Sequence Data
>SC203158 3’UTR clone of NM_030589
The sequence shown below is from the reference sequence of NM_030589. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AACTACACCATGAGCTTCCTGCCCCGCTGAGCGAGGGCTGTGCCGGTGCAGGTCTGGTGGGCGGGGCCA
GGGAAAGGCGGGGTCAGGGCGGGGTTCGCGGAAGAGGCGGGTATAAGAATGGGGGGAAGATGCGGGAAA
GGAAGGGGCGTGGTGGCTAGAGGGAAGAGAAGAAACAGAAGCGGCTCAGTTCACCTTGATAAGGTGCTT
CCGAGCTGGGATGAGAGGAAGGGAAACCTTACATTATGCTATGAAGAGTAGTAATAATAGCAGCTCTTA
TTTCCTGA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_030589.3
Summary This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum; its substrate has not yet been determined. This gene, which produces two transcript variants, is part of a large cluster of cytochrome P450 genes from the CYP2A, CYP2B and CYP2F subfamilies on chromosome 19q. [provided by RefSeq, Jul 2008]
Locus ID 1549
MW 10.4

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.