RNPC3 (NM_017619) Human 3' UTR Clone

CAT#: SC202775

3' UTR clone of RNA-binding region (RNP1 RRM) containing 3 (RNPC3) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: RNPC3
• Synonyms: IGHD5; RBM40; RNP; SNRNP65
• ACCN: NM_017619
• Insert Size: 248 bp
• Sequence Data:
  Insert Sequence

  >SC202775 3’UTR clone of NM_017619
  The sequence shown below is from the reference sequence of NM_017619. The complete sequence of this clone may contain minor differences, such as SNPs.
  Blue=Stop Codon Red=Cloning site
  
  GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
  TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
  GATCCTAAGGAAGGAAAAAGAAAGTGTTAAAAATTAATAAAGGTTTTTTTGAATCCCGTGTCCTTCAAG
  TGCTTTCTAACTTTGAGAGGAAGAAATTGACCACCTGGACTATGGAACTGTGCGTAACAGCTTTGAAAG
  TGTATTTAAAAATTAAATCTATATGCCTTTAAATCAGTGAATTGGAAACATATTACATGTATTTTAATG
  ATTTTCCTCAAATATAATAAATTGTTTCCTTTCCAATAAAA
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
  CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
  
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_017619.4
• Summary: Two types of spliceosomes catalyze splicing of pre-mRNAs. The major U2-type spliceosome is found in all eukaryotes and removes U2-type introns, which represent more than 99% of pre-mRNA introns. The minor U12-type spliceosome is found in some eukaryotes and removes U12-type introns, which are rare and have distinct splice consensus signals. The U12-type spliceosome consists of several small nuclear RNAs and associated proteins. This gene encodes a 65K protein that is a component of the U12-type spliceosome. This protein contains two RNA recognition motifs (RRMs), suggesting that it may contact one of the small nuclear RNAs of the minor spliceosome. [provided by RefSeq, Jul 2008]
• Locus ID: 55599
• MW: 9.6