Deoxyguanosine kinase (DGUOK) (NM_080916) Human 3' UTR Clone

CAT#: SC202657

3' UTR clone of deoxyguanosine kinase (DGUOK) nuclear gene encoding mitochondrial protein transcript variant 1 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: Deoxyguanosine kinase
• Synonyms: dGK; MTDPS3; NCPH; PEOB4
• ACCN: NM_080916
• Insert Size: 240 bp
• Sequence Data:
  Insert Sequence

  >SC202657 3’UTR clone of NM_080916
  The sequence shown below is from the reference sequence of NM_080916. The complete sequence of this clone may contain minor differences, such as SNPs.
  Blue=Stop Codon Red=Cloning site
  
  GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
  TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
  GAGGTAAACACCTTTGTAAAGAATCTGTAACCAATACCATGAAGTTCAGGCTGTGATCTGGGCTCCCTG
  ACTTTCTGAAGCTAGAAAAATGTTGTGTCTCCCAACCACCTTTCCATCCCCAGCCCCTCTCATCCCTGG
  AGCACTCTGCCGCTCAAGAGCTGGTTTGTTAATTATTGTTAGACTTTGCCATTGTTTTCTTTTGTACCT
  GAAGCATTTTGAAAATAAAGTTTACTTAAGTTA
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
  CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
  
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
• Note: Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required.

Reference Data

• RefSeq: NM_080916.3
• Summary: In mammalian cells, the phosphorylation of purine deoxyribonucleosides is mediated predominantly by two deoxyribonucleoside kinases, cytosolic deoxycytidine kinase and mitochondrial deoxyguanosine kinase. The protein encoded by this gene is responsible for phosphorylation of purine deoxyribonucleosides in the mitochondrial matrix. In addition, this protein phosphorylates several purine deoxyribonucleoside analogs used in the treatment of lymphoproliferative disorders, and this phosphorylation is critical for the effectiveness of the analogs. Alternative splice variants encoding different protein isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
• Locus ID: 1716
• MW: 8.9