PPAPDC1B (PLPP5) (NM_001102560) Human 3' UTR Clone

CAT#: SC202636

3' UTR clone of phosphatidic acid phosphatase type 2 domain containing 1B (PPAPDC1B) transcript variant 3 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: PLPP5
• Synonyms: DPPL1; HTPAP; PPAPDC1B
• ACCN: NM_001102560
• Insert Size: 247 bp
• Sequence Data:
  Insert Sequence

  >SC202636 3’UTR clone of NM_001102560
  The sequence shown below is from the reference sequence of NM_001102560. The complete sequence of this clone may contain minor differences, such as SNPs.
  Blue=Stop Codon Red=Cloning site
  
  GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
  TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
  CACATCATTGAATTTAACCTAGAAAGCTAGTAGGGATGGGAAAATCTGACTACTCTTGTTTCTACAATT
  TGGAAAATCCCCCCTTCTTTAGTAACTCCACAGTTTAACAAGTCTGAGCCTTGACTATTTGGGTAAATA
  TTACAGAACAGAAAGGTAGTTTACCTTCATGAGATTTGCACATTTAATTGTTATATTATTTGCCTAGAT
  CCTGCAATCTTGTACTAGCAATAAAAATACCTTTAACGAA
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
  CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
  
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001102560.2
• Summary: Displays magnesium-independent phosphatidate phosphatase activity in vitro. Catalyzes the conversion of phosphatidic acid to diacylglycerol. May be a metastatic suppressor for hepatocellular carcinoma.[UniProtKB/Swiss-Prot Function]
• Locus ID: 84513
• MW: 9.7