ASPM (NM_018136) Human 3' UTR Clone

CAT#: SC202486

3' UTR clone of asp (abnormal spindle) homolog microcephaly associated (Drosophila) (ASPM) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: ASPM
• Synonyms: ASP; Calmbp1; MCPH5
• ACCN: NM_018136
• Insert Size: 222 bp
• Sequence Data:
  Insert Sequence

  >SC202486 3' UTR clone of NM_018136
  The sequence shown below is from the reference sequence of NM_018136. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TGGTGATGGATACGCTTGGCATTCCTTATTAGTAAATGTAAACATTTTCAGTATGTATAGTGTAAAGAAA
  TATTAAAGCCAATCATGAGTACGTAAAGTGATTTTTGCTCTCCGTGTACAACTTTTAAAATCTGACTTTG
  TTTTAAAAAAACATAAACTGTTCATTACATTCTTCATTTTTATCATTTATAGTTTTATGCATGTAATAAA
  CTAATATGTCAT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_018136.4
• Summary: This gene is the human ortholog of the Drosophila melanogaster 'abnormal spindle' gene (asp), which is essential for normal mitotic spindle function in embryonic neuroblasts. Studies in mouse also suggest a role of this gene in mitotic spindle regulation, with a preferential role in regulating neurogenesis. Mutations in this gene are associated with microcephaly primary type 5. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, May 2011]
• Locus ID: 259266