MDH1 (NM_005917) Human 3' UTR Clone

CAT#: SC202354

3' UTR clone of malate dehydrogenase 1 NAD (soluble) (MDH1) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: MDH1
• Synonyms: DEE88; EIEE88; HEL-S-32; KAR; MDH-s; MDHA; MGC:1375; MOR2
• ACCN: NM_005917
• Insert Size: 240 bp
• Sequence Data:
  Insert Sequence

  >SC202354 3’UTR clone of NM_005917
  The sequence shown below is from the reference sequence of NM_005917. The complete sequence of this clone may contain minor differences, such as SNPs.
  Blue=Stop Codon Red=Cloning site
  
  GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
  TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
  AGTGCTTTTGAATTTCTTTCCTCTGCCTGACTAGACAATGATGTTACTAAATGCTTCAAAGCTGAAGAA
  TCTAAATGTCGTCTTTGACTCAAGTACCAAATAATAATAATGCTATACTTAAATTACTTGTGAAAAACA
  ACACATTTTAAAGATTACGTGCTTCTTGGTACAGGTTTGTGAATGACAGTTTATCGTCATGCTGTTAGT
  GTGCATTCTAAATAAATATATATTCAAATGAAA
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
  CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
  
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_005917.4
• Summary: This gene encodes an enzyme that catalyzes the NAD/NADH-dependent, reversible oxidation of malate to oxaloacetate in many metabolic pathways, including the citric acid cycle. Two main isozymes are known to exist in eukaryotic cells: one is found in the mitochondrial matrix and the other in the cytoplasm. This gene encodes the cytosolic isozyme, which plays a key role in the malate-aspartate shuttle that allows malate to pass through the mitochondrial membrane to be transformed into oxaloacetate for further cellular processes. Alternatively spliced transcript variants have been found for this gene. A recent study showed that a C-terminally extended isoform is produced by use of an alternative in-frame translation termination codon via a stop codon readthrough mechanism, and that this isoform is localized in the peroxisomes. Pseudogenes have been identified on chromosomes X and 6. [provided by RefSeq, Feb 2016]
• Locus ID: 4190
• MW: 9.4