ACADVL (NM_000018) Human 3' UTR Clone

CAT#: SC202266

3' UTR clone of acyl-Coenzyme A dehydrogenase very long chain (ACADVL) nuclear gene encoding mitochondrial protein transcript variant 1 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: ACADVL
• Synonyms: ACAD6; LCACD; VLCAD
• ACCN: NM_000018
• Insert Size: 199 bp
• Sequence Data:
  Insert Sequence

  >SC202266 3’UTR clone of NM_000018
  The sequence shown below is from the reference sequence of NM_000018. The complete sequence of this clone may contain minor differences, such as SNPs.
  Blue=Stop Codon Red=Cloning site
  
  GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
  TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
  GTGGTCACCAGCAACCCACTTGGCTTCTGAATACTCCCGGCCAGGGCCTGTCCCAGTTATGTGCCTTCC
  CTCAAGCCAAAGCCGAAGCCCCTTTCCTTAAGGCCCTGGTTTGTCCCGAAGGGGCCTAGTGTTCCCAGC
  ACTGTGCCTGCTCTCAAGAGCACTTACTGCCTCGCAAATAATAAAAATTTCTAGCCAGTCA
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
  CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
  
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_000018.4
• Summary: The protein encoded by this gene is targeted to the inner mitochondrial membrane where it catalyzes the first step of the mitochondrial fatty acid beta-oxidation pathway. This acyl-Coenzyme A dehydrogenase is specific to long-chain and very-long-chain fatty acids. A deficiency in this gene product reduces myocardial fatty acid beta-oxidation and is associated with cardiomyopathy. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
• Locus ID: 37
• MW: 7.1