Troponin C1 (TNNC1) (NM_003280) Human 3' UTR Clone

CAT#: SC202092

3' UTR clone of troponin C type 1 (slow) (TNNC1) for miRNA target validation


Reconstitution Protocol

USD 683.00

4 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

USD 188.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00

Other products for "TNNC1"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol TNNC1
Synonyms CMD1Z; CMH13; TN-C; TNC; TNNC
ACCN NM_003280
Insert Size 205 bp
Sequence Data
>SC202092 3’UTR clone of NM_003280
The sequence shown below is from the reference sequence of NM_003280. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TTCCTGGAGTTCATGAAGGGTGTGGAGTAGATGCTGACCTTCACCCAGAGCTGCCTATGCCCAGCCTCC
AACTCCAGCTGAGTCCTGGGGTTGGGGAGGGGGTCGGGGTCCCAGGACCTGAGCCTGGCCATGTCCTCA
ACCCCAAATCCCCCGACTCCCTCCCCAGATCTGTCCTGGGGGATGCAAATAAAGCCTGCTCTCCCAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_003280.3
Summary Troponin is a central regulatory protein of striated muscle contraction, and together with tropomyosin, is located on the actin filament. Troponin consists of 3 subunits: TnI, which is the inhibitor of actomyosin ATPase; TnT, which contains the binding site for tropomyosin; and TnC, the protein encoded by this gene. The binding of calcium to TnC abolishes the inhibitory action of TnI, thus allowing the interaction of actin with myosin, the hydrolysis of ATP, and the generation of tension. Mutations in this gene are associated with cardiomyopathy dilated type 1Z. [provided by RefSeq, Oct 2008]
Locus ID 7134
MW 7.2

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.