C2CD3 (NM_015531) Human 3' UTR Clone

CAT#: SC201921

3' UTR clone of C2 calcium-dependent domain containing 3 (C2CD3) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: C2CD3
• Synonyms: OFD14
• ACCN: NM_015531
• Insert Size: 186 bp
• Sequence Data:
  Insert Sequence

  >SC201921 3’UTR clone of NM_015531
  The sequence shown below is from the reference sequence of NM_015531. The complete sequence of this clone may contain minor differences, such as SNPs.
  Blue=Stop Codon Red=Cloning site
  
  GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
  TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
  GTCAGCTCCTTAATCACAGGTAGTTACTGAAGTAACTGGAAGCATGAACATGCCCACCAGGACTCCCAG
  CTCCCAACGATTCCTGAGCATGAGCAGATAGTCTCTGAAAGCATTTCCACAGATGTATCCACAACTATA
  GATTAGATTCTGGTCCTCTGATATTAGAATAAAGTACTAAAAATTGTA
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
  CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
  
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_015531.6
• Summary: This gene encodes a protein that functions as a regulator of centriole elongation. Studies of the orthologous mouse protein show that it promotes centriolar distal appendage assembly and is also required for the recruitment of other ciliogenic proteins, including intraflagellar transport proteins. Mutations in this gene cause orofaciodigital syndrome XIV (OFD14), a ciliopathy resulting in malformations of the oral cavity, face and digits. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Nov 2014]
• Locus ID: 26005
• MW: 7