TAS1R1 (NM_177540) Human 3' UTR Clone

CAT#: SC201913

3' UTR clone of taste receptor type 1 member 1 (TAS1R1) transcript variant 3 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: TAS1R1
• Synonyms: GM148; GPR70; T1R1; TR1
• ACCN: NM_177540
• Insert Size: 201 bp
• Sequence Data:
  Insert Sequence

  >SC201913 3’UTR clone of NM_177540
  The sequence shown below is from the reference sequence of NM_177540. The complete sequence of this clone may contain minor differences, such as SNPs.
  Blue=Stop Codon Red=Cloning site
  
  GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
  TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
  GACTACACGAGGCGCTGCGGCTCCACCTGACCAGTGGGTCAGCAGGCACGGCTGGCAGCCTTCTCTGCC
  CTGAGGGTCGAAGGTCGAGCAGGCCGGGGGTGTCCGGGAGGTCTTTGGGCATCGCGGTCTGGGGTTGGG
  ACGTGTAAGCGCCTGGGAGAGCCTAGACCAGGCTCCGGGCTGCCAATAAAGAAGTGAAATGCG
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
  CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
  
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_177540.3
• Summary: The protein encoded by this gene is a G protein-coupled receptor and is a component of the heterodimeric amino acid taste receptor T1R1+3. The T1R1+3 receptor responds to L-amino acids but not to D-enantiomers or other compounds. Most amino acids that are perceived as sweet activate T1R1+3, and this activation is strictly dependent on an intact T1R1+3 heterodimer. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2010]
• Locus ID: 80835
• MW: 7