GTF2A1 (NM_201595) Human 3' UTR Clone

CAT#: SC201782

3' UTR clone of general transcription factor IIA1 19/37kDa (GTF2A1) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: GTF2A1
• Synonyms: TF2A1; TFIIA; TFIIA-42; TFIIAL
• ACCN: NM_201595
• Insert Size: 184 bp
• Sequence Data:
  Insert Sequence

  >SC201782 3' UTR clone of NM_201595
  The sequence shown below is from the reference sequence of NM_201595. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CCAAAGCCATTGGAGATGCAGAATGGTGAAGAGTTGCTTTTTTTCTTTTATAAATAAAAGAAACTTAAAA
  AAAATGTAAAGCGGACAGTTTGAAACTTGGGGCATATGCCAACCAAAACTTCGTTTCTGCATGTCAGAAA
  AGTGCAGTAGAAGCAAAGCTACTGGAACAAAGATAGACCTTGAC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_201595.1
• Summary: Accurate transcription initiation on TATA-containing class II genes involves the ordered assembly of RNA polymerase II (POLR2A; MIM 180660) and several general initiation factors (summarized by DeJong and Roeder, 1993 [PubMed 8224848]). One of these factors is TFIIA, which when purified from HeLa extracts consists of 35-, 19-, and 12-kD subunits.[supplied by OMIM, Jul 2010]
• Locus ID: 2957