ATP5PF (NM_001003701) Human 3' UTR Clone

CAT#: SC201671

3' UTR clone of ATP synthase H+ transporting mitochondrial F0 complex subunit F6 (ATP5J) nuclear gene encoding mitochondrial protein transcript variant 5

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: ATP5PF
• Synonyms: ATP5; ATP5A; ATP5J; ATPM; CF6; F6
• ACCN: NM_001003701
• Insert Size: 170 bp
• Sequence Data:
  Insert Sequence

  >SC201671 3’UTR clone of NM_001003701
  The sequence shown below is from the reference sequence of NM_001003701. The complete sequence of this clone may contain minor differences, such as SNPs.
  Blue=Stop Codon Red=Cloning site
  
  GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
  TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
  TTTGAAGTCATCGAAAAACCCCAGGCCTGAAGAAATAAAGTAAAATTAATCTGGTAATTTGTCACGGAT
  TAGTTGTACAACTAGTTAGAAGTTTCAGAATAAACATGCATTTCATAACTGTCAAATGTTCTTTTAATT
  CTGAGTCCAAATAAATTATTTGGTGATGTTGA
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
  CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
  
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001003701.2
• Summary: Mitochondrial ATP synthase catalyzes ATP synthesis, utilizing an electrochemical gradient of protons across the inner membrane during oxidative phosphorylation. It is composed of two linked multi-subunit complexes: the soluble catalytic core, F1, and the membrane-spanning component, Fo, which comprises the proton channel. The F1 complex consists of 5 different subunits (alpha, beta, gamma, delta, and epsilon) assembled in a ratio of 3 alpha, 3 beta, and a single representative of the other 3. The Fo complex has nine subunits (a, b, c, d, e, f, g, F6 and 8). This gene encodes the F6 subunit of the Fo complex. The F6 subunit is required for F1 and Fo interactions. Alternatively spliced transcript variants encoding different isoforms have been identified for this gene. This gene has 1 or more pseudogenes. [provided by RefSeq, Feb 2016]
• Locus ID: 522
• MW: 6.5