ACOT1 (NM_001037161) Human 3' UTR Clone

CAT#: SC201224

3' UTR clone of acyl-CoA thioesterase 1 (ACOT1) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: ACOT1
• Synonyms: ACH2; CTE-1; LACH2
• ACCN: NM_001037161
• Insert Size: 171 bp
• Sequence Data:
  Insert Sequence

  >SC201224 3’UTR clone of NM_001037161
  The sequence shown below is from the reference sequence of NM_001037161. The complete sequence of this clone may contain minor differences, such as SNPs.
  Blue=Stop Codon Red=Cloning site
  
  GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
  TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
  CACGAGGGGACAATCCCATCAAAAGTGTAAATTTTATTTGATCATGTGGCCTCTCTGTTGCTAATCTCT
  CCTGGAAACATCTGCCACATTTAGTGTGTGTATGTGTATTCATTCTTTCTCATAACTTCTTAAAGTTTC
  TTCCCCTCATTATTAAAATGAATTTACCAGTAA
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
  CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
  
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001037161.2
• Summary: Acyl-CoA thioesterases are a group of enzymes that catalyze the hydrolysis of acyl-CoAs into free fatty acids and coenzyme A (CoASH), regulating intracellular levels of acyl-CoAs, free fatty acids and CoASH. More active towards saturated and unsaturated long chain fatty acyl-CoAs (C12-C20).[UniProtKB/Swiss-Prot Function]
• Locus ID: 641371
• MW: 6.3