Prothrombin (F2) (NM_000506) Human 3' UTR Clone

CAT#: SC200711

3' UTR clone of coagulation factor II (thrombin) (F2) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: F2
• Synonyms: PT; RPRGL2; THPH1
• ACCN: NM_000506
• Insert Size: 128 bp
• Sequence Data:
  Insert Sequence

  >SC200711 3’UTR clone of NM_000506
  The sequence shown below is from the reference sequence of NM_000506. The complete sequence of this clone may contain minor differences, such as SNPs.
  Blue=Stop Codon Red=Cloning site
  
  GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
  TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
  CAGAAGGTCATTGATCAGTTTGGAGAGTAGGGGGCCACTCATATTCTGGGCTCCTGGAACCAATCCCGT
  GAAAGAATTATTTTTGTGTTTCTAAAACTATGGTTCCCAATAAAAGTGACTCTCAGCGA
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
  CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
  
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_000506.5
• Summary: This gene encodes the prothrombin protein (also known as coagulation factor II). This protein is proteolytically cleaved in multiple steps to form the activated serine protease thrombin. The activated thrombin enzyme plays an important role in thrombosis and hemostasis by converting fibrinogen to fibrin during blood clot formation, by stimulating platelet aggregation, and by activating additional coagulation factors. Thrombin also plays a role in cell proliferation, tissue repair, and angiogenesis as well as maintaining vascular integrity during development and postnatal life. Peptides derived from the C-terminus of this protein have antimicrobial activity against E. coli and P. aeruginosa. Mutations in this gene lead to various forms of thrombosis and dysprothrombinemia. Rapid increases in cytokine levels following coronavirus infections can dysregulate the coagulation cascade and produce thrombosis, compromised blood supply, and organ failure. [provided by RefSeq, May 2020]
• Locus ID: 2147
• MW: 4.9