TCIRG1 (NM_006019) Human 3' UTR Clone

CAT#: SC200605

3' UTR clone of T-cell immune regulator 1 ATPase H+ transporting lysosomal V0 subunit A3 (TCIRG1) transcript variant 1


Reconstitution Protocol

USD 683.00

4 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

USD 188.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00

Other products for "TCIRG1"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol TCIRG1
Synonyms a3; Atp6i; ATP6N1C; ATP6V0A3; OC-116kDa; OC116; OPTB1; Stv1; TIRC7; Vph1
ACCN NM_006019
Insert Size 106 bp
Sequence Data
>SC200605 3’UTR clone of NM_006019
The sequence shown below is from the reference sequence of NM_006019. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CCCTTCACCTTCGCTGCCACAGATGACTAGGGCCCACTGCAGGTCCTGCCAGACCTCCTTCCTGACCTC
TGAGGCAGGAGAGGAATAAAGACGGTCCGCCCTGGCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_006019.4
Summary This gene encodes a subunit of a large protein complex known as a vacuolar H+-ATPase (V-ATPase). The protein complex acts as a pump to move protons across the membrane. This movement of protons helps regulate the pH of cells and their surrounding environment. V-ATPase dependent organelle acidification is necessary for such intracellular processes as protein sorting, zymogen activation, and receptor-mediated endocytosis. V-ATPase is comprised of a cytosolic V1 domain and a transmembrane V0 domain. Alternative splicing results in multiple transcript variants. Mutations in this gene are associated with infantile malignant osteopetrosis. [provided by RefSeq, May 2017]
Locus ID 10312
MW 3.8

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.