PAFAH1B3 (NM_001145939) Human 3' UTR Clone

CAT#: SC200049

3' UTR clone of platelet-activating factor acetylhydrolase isoform Ib subunit 3 (29kDa) (PAFAH1B3) transcript variant 1 for miRNA target validation


Reconstitution Protocol

USD 683.00

4 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

USD 188.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00

Other products for "PAFAH1B3"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol PAFAH1B3
Synonyms PAFAHG
ACCN NM_001145939
Insert Size 73 bp
Sequence Data
>SC200049 3’UTR clone of NM_001145939
The sequence shown below is from the reference sequence of NM_001145939. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GGTGCTCCCCTGCTGGAGCCCGCACCCTAAGCATCCTGCTGCCTTCCCACAACATTAAACTCTCCTTCC
TCAG
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_001145939.2
Summary This gene encodes an acetylhydrolase that catalyzes the removal of an acetyl group from the glycerol backbone of platelet-activating factor. The encoded enzyme is a subunit of the platelet-activating factor acetylhydrolase isoform 1B complex, which consists of the catalytic beta and gamma subunits and the regulatory alpha subunit. This complex functions in brain development. A translocation between this gene on chromosome 19 and the CDC-like kinase 2 gene on chromosome 1 has been observed, and was associated with cognitive disability, ataxia, and atrophy of the brain. Alternatively spliced transcript variants have been described. [provided by RefSeq, Mar 2009]
Locus ID 5050
MW 2.3

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.