PAFAH1B3 (NM_002573) Human 3' UTR Clone

CAT#: SC200045

3' UTR clone of platelet-activating factor acetylhydrolase isoform Ib subunit 3 (29kDa) (PAFAH1B3) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: PAFAH1B3
• Synonyms: PAFAHG
• ACCN: NM_002573
• Insert Size: 73 bp
• Sequence Data:
  Insert Sequence

  >SC200045 3’UTR clone of NM_002573
  The sequence shown below is from the reference sequence of NM_002573. The complete sequence of this clone may contain minor differences, such as SNPs.
  Blue=Stop Codon Red=Cloning site
  
  GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
  TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
  GGTGCTCCCCTGCTGGAGCCCGCACCCTAAGCATCCTGCTGCCTTCCCACAACATTAAACTCTCCTTCC
  TCAG
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
  CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
  
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_002573.4
• Summary: This gene encodes an acetylhydrolase that catalyzes the removal of an acetyl group from the glycerol backbone of platelet-activating factor. The encoded enzyme is a subunit of the platelet-activating factor acetylhydrolase isoform 1B complex, which consists of the catalytic beta and gamma subunits and the regulatory alpha subunit. This complex functions in brain development. A translocation between this gene on chromosome 19 and the CDC-like kinase 2 gene on chromosome 1 has been observed, and was associated with cognitive disability, ataxia, and atrophy of the brain. Alternatively spliced transcript variants have been described. [provided by RefSeq, Mar 2009]
• Locus ID: 5050
• MW: 2.3