OriGene Logo
Search:    
Left ProductsProducts divider ServicesServices divider technologyTechnology divider researchResearch divider TechsupportTechSupport divider AboutAbout Right
 
Home Support FAQs Lenti FAQs

Lenti FAQs

1. Q: How do I propagate the pLenti vector in E. coli?
A: Due to the directly repeats of LTR regions of lentiviral vectors, recombination deficient E. coli competent cells are recommended, such as Stbl3 from ThermoFisher, cat# A10469.
2. Q: Can I use the pLenti vector for stable selection in mammalian cells?
A: Some of the pLenti vectors have mammalian selectable markers and those without a mammalian selection marker cannot be used for mammalian selection. There are two types of selection markers, antibiotics or fluorescent proteins.
3. Q: What is the size limit for the ORF that is to be cloned into the pLenti vector?
A: In general, lentiviral vectors have the capacity to accommodate an insert of 9 kb. However, ORFs of 6kb have been successfully been cloned into pLenti-C-Myc-DDK vector and packaged into lentivirus. For lentiviral vectors with more features such as selection markers, the ORF size will decrease accordingly.
4. Q: Can I use a second generation packaging system with the pLenti vectors?
A: Yes, a second generation packaging system should work with OriGene’s third generation pLenti vectors although we have not explicitly tested this. You can use OriGene’s third generation packaging kit, cat# TR30037 for pLenti-vectors.
5. Q: Can I use OriGene’s Lenti-vpack packaging kit to package a second generation lentiviral vector?
A: No. OriGene’s Lenti-vpack packaging kit is used for the third generation lentiviral vectors, such as all of the lentiviral vectors from OriGene.
6. Q: What is MOI? What MOI should I use for my cell line?
A: MOI is MOI stands for Multiplicity Of Infection; the number of lentiviral particles per cell. The optimal MOI for each cell line varies. For each cell line, a range of MOI from 5-100 needs to be tested using a positive control particles containing a fluorescent protein marker, such as OriGene’s GFP control lentiviral particle (cat# PS100071V). The chart below shows the recommended MOI for common cell lines as a point of reference

Cell linesRecommeneded MOI
A54940
C2C12200
Caco2100
HCT11620
HEK293T20
Hela80
Hep3B50
HuH720
Jurkat40
MCF-760
NK9250
PC340
SH-SY5Y5
SKNMC20
THP180
U2OS20
7. Q: Sequences of the sequencing primers:
A: EF50 (forward seq primer for lenti-EF1a vectors)
5’ CTTCCATTTCAGGTGTCGTGAC 3’  TM: 55C

V2 (forward seq primer for lenti-CMV vectors)
5’ AGAGCTCGTTTAGTGAA  3’ TM: 42C

LR50 (reverse seq primer for lenti-ORF vectors)
5’ CAGAGGTTGATTATCGATAAG 3’ TM: 48.5C

8. Q: What is the difference between a lentivirus and a retrovirus?
A: Lenti viruses are a subtype of retrovirus. The main difference between lentiviruses and standard retroviruses from an experimental standpoint is lentiviruses are capable of infecting both non-dividing and actively dividing cell types whereas standard retroviruses can only infect mitotically active cell types. Both lentiviruses and standard retroviruses use the gag, pol, and env genes for packaging. However, the isoforms of these proteins used by retroviruses and lentiviruses are different and lentiviral vectors may not be efficiently packaged by each other’s packaging systems.

 

liner
Inc 5000 Healthcare Company