APC Human Gene Knockout Kit (CRISPR)

CAT#: KN211629BN

APC - human gene knockout kit via CRISPR, HDR mediated

Functional Cassette: GFP-puro Luciferase-Puro RFP-BSD mBFP-Neo



HDR-mediated knockout kit validation

  See Other Versions

USD 1,657.00

4 Weeks*

Size
    • 1 kit

Product Images

Frequently bought together (3)
pCAS-Scramble, pCas-Guide vector with a scrambled sequence as a negative control (10 µg)
    • 10 ug

USD 450.00


APC mouse monoclonal antibody, clone OTI2B8 (formerly 2B8)
    • 100 ul

USD 447.00


APC (Myc-DDK-tagged)-Human adenomatous polyposis coli (APC), transcript variant 1
    • 10 ug

USD 3,455.00

Specifications

Product Data
Format 2 gRNA vectors, 1 mBFP-Neo donor, 1 scramble control
Donor DNA mBFP-Neo
Symbol APC
Locus ID 324
Components

KN211629G1, APC gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: GGCGACCGGACCCGAGCCCA

KN211629G2, APC gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: GGTGGTACAGAAGCGGGCAA

KN211629BND, donor DNA containing left and right homologous arms and mBFP-Neo functional cassette.

GE100003, scramble sequence in pCas-Guide vector

Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.
Reference Data
RefSeq NM_000038, NM_001127510, NM_001127511, NM_001354895, NM_001354896, NM_001354897, NM_001354898, NM_001354899, NM_001354900, NM_001354901, NM_001354902, NM_001354903, NM_001354904, NM_001354905, NM_001354906
UniProt ID P25054
Synonyms BTPS2; DP2; DP2.5; DP3; GS; PPP1R46
Summary This gene encodes a tumor suppressor protein that acts as an antagonist of the Wnt signaling pathway. It is also involved in other processes including cell migration and adhesion, transcriptional activation, and apoptosis. Defects in this gene cause familial adenomatous polyposis (FAP), an autosomal dominant pre-malignant disease that usually progresses to malignancy. Mutations in the APC gene have been found to occur in most colorectal cancers. Disease-associated mutations tend to be clustered in a small region designated the mutation cluster region (MCR) and result in a truncated protein product. [provided by RefSeq, Dec 2019]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.