BCMA (TNFRSF17) Human Gene Knockout Kit (CRISPR)
CAT#: KN208851BN
BCMA/TNFRSF17 - human gene knockout kit via CRISPR, HDR mediated
Functional Cassette: GFP-puro Luciferase-Puro RFP-BSD
HDR-mediated knockout kit validation
USD 1,657.00
4 Weeks*
USD 450.00
USD 450.00
Specifications
Product Data | |
Format | 2 gRNA vectors, 1 mBFP-Neo donor, 1 scramble control |
Donor DNA | mBFP-Neo |
Symbol | BCMA |
Locus ID | 608 |
Components |
KN208851G1, BCMA gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: GAAGAACATCGAAGTTGACA KN208851G2, BCMA gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: TAACGCTGACATGTTAGAGG KN208851BND, donor DNA containing left and right homologous arms and mBFP-Neo functional cassette. GE100003, scramble sequence in pCas-Guide vector |
Disclaimer | These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process. |
Reference Data | |
RefSeq | NM_001192 |
UniProt ID | Q02223 |
Synonyms | BCM; BCMA; CD269; TNFRSF13A |
Summary | The protein encoded by this gene is a member of the TNF-receptor superfamily. This receptor is preferentially expressed in mature B lymphocytes, and may be important for B cell development and autoimmune response. This receptor has been shown to specifically bind to the tumor necrosis factor (ligand) superfamily, member 13b (TNFSF13B/TALL-1/BAFF), and to lead to NF-kappaB and MAPK8/JNK activation. This receptor also binds to various TRAF family members, and thus may transduce signals for cell survival and proliferation. [provided by RefSeq, Jul 2008] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
KN208851 | BCMA/TNFRSF17 - human gene knockout kit via CRISPR, HDR mediated |
USD 1,657.00 |
|
KN208851LP | BCMA/TNFRSF17 - human gene knockout kit via CRISPR, HDR mediated |
USD 1,657.00 |
|
KN208851RB | BCMA/TNFRSF17 - human gene knockout kit via CRISPR, HDR mediated |
USD 1,657.00 |
|
KN408851 | BCMA/TNFRSF17 - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. |
USD 1,657.00 |
|
GA100418 | TNFRSF17 CRISPRa kit - CRISPR gene activation of human TNF receptor superfamily member 17 |
USD 1,657.00 |
{0} Product Review(s)
Be the first one to submit a review