Human RAB18 activation kit by CRISPRa

CAT#: GA107922

RAB18 CRISPRa kit - CRISPR gene activation of human RAB18, member RAS oncogene family

Product Images

Specifications

Product Data

• Format: 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
• Symbol: RAB18
• Locus ID: 22931
• Kit Components:

  GA107922G1, RAB18 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: AGTCCTCCCACTGACTCAAA

  GA107922G2, RAB18 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GAGCTACCTCAAGGCGGAAC

  GA107922G3, RAB18 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: TCCTTTCACACCGGGTGTTC

  1 CRISPRa-Enhancer vector, SKU GE100056

  1 CRISPRa scramble vector, SKU GE100077

• Disclaimer: These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.

Reference Data

• RefSeq: NM_001256410, NM_001256411, NM_001256412, NM_001256415, NM_021252, NR_046172, N56901
• UniProt ID: Q9NP72
• Synonyms: RAB18LI1; WARBM3
• Summary: The protein encoded by this gene is a member of a family of Ras-related small GTPases that regulate membrane trafficking in organelles and transport vesicles. Knockdown studies is zebrafish suggest that this protein may have a role in eye and brain development. Mutations in this gene are associated with Warburg micro syndrome type 3. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2012]