Human Glucose Transporter GLUT1 (SLC2A1) activation kit by CRISPRa

CAT#: GA104438

SLC2A1 CRISPRa kit - CRISPR gene activation of human solute carrier family 2 member 1


  See Other Versions


Find the corresponding CRISPRi Inhibitor Kit

USD 1,657.00

2 Weeks*

Size
    • 1 kit

Product Images

Frequently bought together (2)
Rabbit Polyclonal Antibody against GLUT1
    • 100 ul

USD 620.00


SLC2A1 (Myc-DDK-tagged)-Human solute carrier family 2 (facilitated glucose transporter), member 1 (SLC2A1)
    • 10 ug

USD 457.00

Other products for "SLC2A1"

Specifications

Product Data
Format 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol SLC2A1
Locus ID 6513
Kit Components

GA104438G1, Glucose Transporter GLUT1 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: AGTGCACCGAAGTCACCCAG

GA104438G2, Glucose Transporter GLUT1 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GCTGGACTGGAGTTCTCACT

GA104438G3, Glucose Transporter GLUT1 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: CATTTTGCTAGAGAAGGCCG

1 CRISPRa-Enhancer vector, SKU GE100056

1 CRISPRa scramble vector, SKU GE100077

Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq NM_006516
UniProt ID P11166
Synonyms CSE; DYT9; DYT17; DYT18; EIG12; GLUT; GLUT-1; GLUT1; GLUT1DS; HTLVR; PED; SDCHCN
Summary This gene encodes a major glucose transporter in the mammalian blood-brain barrier. The encoded protein is found primarily in the cell membrane and on the cell surface, where it can also function as a receptor for human T-cell leukemia virus (HTLV) I and II. Mutations in this gene have been found in a family with paroxysmal exertion-induced dyskinesia. [provided by RefSeq, Apr 2013]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.