Human c-Myc (MYC) activation kit by CRISPRa

CAT#: GA103055

MYC CRISPRa kit - CRISPR gene activation of human MYC proto-oncogene, bHLH transcription factor

Product Images

Specifications

Product Data

• Format: 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
• Symbol: MYC
• Locus ID: 4609
• Kit Components:

  GA103055G1, c-Myc gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: ATTATGTATGCACAGCTATC

  GA103055G2, c-Myc gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GCTGCTTTGGCAGCAAATTG

  GA103055G3, c-Myc gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: CAAATTGGGGGACTCAGTCT

  1 CRISPRa-Enhancer vector, SKU GE100056

  1 CRISPRa scramble vector, SKU GE100077

• Disclaimer: These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.

Reference Data

• RefSeq: NM_002467, NM_001354870
• UniProt ID: P01106
• Synonyms: bHLHe39; c-Myc; MRTL; MYCC
• Summary: This gene is a proto-oncogene and encodes a nuclear phosphoprotein that plays a role in cell cycle progression, apoptosis and cellular transformation. The encoded protein forms a heterodimer with the related transcription factor MAX. This complex binds to the E box DNA consensus sequence and regulates the transcription of specific target genes. Amplification of this gene is frequently observed in numerous human cancers. Translocations involving this gene are associated with Burkitt lymphoma and multiple myeloma in human patients. There is evidence to show that translation initiates both from an upstream, in-frame non-AUG (CUG) and a downstream AUG start site, resulting in the production of two isoforms with distinct N-termini. [provided by RefSeq, Aug 2017]