Human Lipoprotein a (LPA) activation kit by CRISPRa

CAT#: GA102725

LPA CRISPRa kit - CRISPR gene activation of human lipoprotein(a)


  See Other Versions


Find the corresponding CRISPRi Inhibitor Kit

USD 1,657.00

2 Weeks*

Size
    • 1 kit

Product Images

Frequently bought together (2)
LPA (Myc-DDK-tagged)-Human lipoprotein, Lp(a) (LPA)
    • 10 ug

USD 2,526.00


Rabbit Polyclonal Anti-LPA Antibody
    • 100 ul

USD 539.00

Specifications

Product Data
Format 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol LPA
Locus ID 4018
Kit Components

GA102725G1, Lipoprotein a gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GGGAGGAAACAAGACTAATC

GA102725G2, Lipoprotein a gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: AGTGCAATGTCAATAGATGC

GA102725G3, Lipoprotein a gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: TTTATAAGACTCTATATTCA

1 CRISPRa-Enhancer vector, SKU GE100056

1 CRISPRa scramble vector, SKU GE100077

Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq NM_005577
Synonyms AK38; APOA; LP
Summary The protein encoded by this gene is a serine proteinase that inhibits the activity of tissue-type plasminogen activator I. The encoded protein constitutes a substantial portion of lipoprotein(a) and is proteolytically cleaved, resulting in fragments that attach to atherosclerotic lesions and promote thrombogenesis. Elevated plasma levels of this protein are linked to atherosclerosis. Depending on the individual, the encoded protein contains 2-43 copies of kringle-type domains. The allele represented here contains 15 copies of the kringle-type repeats and corresponds to that found in the reference genome sequence. [provided by RefSeq, Dec 2009]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.