JNK1 (MAPK8) (NM_001278548) Human Untagged Clone

CAT#: SC335250

MAPK8 (untagged) - Human mitogen-activated protein kinase 8 (MAPK8), transcript variant 5

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: JNK1
• Synonyms: JNK; JNK-46; JNK1; JNK1A2; JNK21B1/2; PRKM8; SAPK1; SAPK1c
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC335250 representing NM_001278548.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGAGCAGAAGCAAGCGTGACAACAATTTTTATAGTGTAGAGATTGGAGATTCTACATTCACAGTCCTG
  AAACGATATCAGAATTTAAAACCTATAGGCTCAGGAGCTCAAGGAATAGTATGCGCAGCTTATGATGCC
  ATTCTTGAAAGAAATGTTGCAATCAAGAAGCTAAGCCGACCATTTCAGAATCAGACTCATGCCAAGCGG
  GCCTACAGAGAGCTAGTTCTTATGAAATGTGTTAATCACAAAAATATAATTGGCCTTTTGAATGTTTTC
  ACACCACAGAAATCCCTAGAAGAATTTCAAGATGTTTACATAGTCATGGAGCTCATGGATGCAAATCTT
  TGCCAAGTGATTCAGATGGAGCTAGATCATGAAAGAATGTCCTACCTTCTCTATCAGATGCTGTGTGGA
  ATCAAGCACCTTCATTCTGCTGGAATTATTCATCGGGACTTAAAGCCCAGTAATATAGTAGTAAAATCT
  GATTGCACTTTGAAGATTCTTGACTTCGGTCTGGCCAGGACTGCAGGAACGAGTTTTATGATGACGCCT
  TATGTAGTGACTCGCTACTACAGAGCACCCGAGGTCATCCTTGGCATGGGCTACAAGGAAAACGCTGAC
  TCAGAACACAACAAACTTAAAGCCAGTCAGGCAAGGGATTTGTTATCCAAAATGCTGGTAATAGATGCA
  TCTAAAAGGATCTCTGTAGATGAAGCTCTCCAACACCCGTACATCAATGTCTGGTATGATCCTTCTGAA
  GCAGAAGCTCCACCACCAAAGATCCCTGACAAGCAGTTAGATGAAAGGGAACACACAATAGAAGAGTGG
  AAAGAATTGATATATAAGGAAGTTATGGACTTGGAGGAGAGAACCAAGAATGGAGTTATACGGGGGCAG
  CCCTCTCCTTTAGCACAGGTGCAGCAGTGA
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001278548
• Insert Size: 927 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001278548.1
• RefSeq Size: 5448 bp
• RefSeq ORF: 927 bp
• Locus ID: 5599
• UniProt ID: P45983
• Cytogenetics: 10q11.22
• Protein Families: Druggable Genome, ES Cell Differentiation/IPS, Protein Kinase
• Protein Pathways: Adipocytokine signaling pathway, Colorectal cancer, Epithelial cell signaling in Helicobacter pylori infection, ErbB signaling pathway, Fc epsilon RI signaling pathway, Focal adhesion, GnRH signaling pathway, Insulin signaling pathway, MAPK signaling pathway, Neurotrophin signaling pathway, NOD-like receptor signaling pathway, Pancreatic cancer, Pathways in cancer, Progesterone-mediated oocyte maturation, RIG-I-like receptor signaling pathway, Toll-like receptor signaling pathway, Type II diabetes mellitus, Wnt signaling pathway
• MW: 35.3 kDa
• Gene Summary: The protein encoded by this gene is a member of the MAP kinase family. MAP kinases act as an integration point for multiple biochemical signals, and are involved in a wide variety of cellular processes such as proliferation, differentiation, transcription regulation and development. This kinase is activated by various cell stimuli, and targets specific transcription factors, and thus mediates immediate-early gene expression in response to cell stimuli. The activation of this kinase by tumor-necrosis factor alpha (TNF-alpha) is found to be required for TNF-alpha induced apoptosis. This kinase is also involved in UV radiation induced apoptosis, which is thought to be related to cytochrom c-mediated cell death pathway. Studies of the mouse counterpart of this gene suggested that this kinase play a key role in T cell proliferation, apoptosis and differentiation. Several alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Apr 2016]
  Transcript Variant: This variant (5) lacks an alternate in-frame segment and uses a different acceptor splice site in the last coding exon compared to transcript variant JNK1-b2, resulting in a frameshift and a shorter isoform (5) with a different C-terminus compared to isoform JNK1 beta2. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.