Junctional Adhesion Molecule 2 (JAM2) (NM_001270407) Human Untagged Clone
CAT#: SC332924
JAM2 (untagged) - Homo sapiens junctional adhesion molecule 2 (JAM2), transcript variant 2
"NM_001270407" in other vectors (2)
Product Images
Frequently bought together (4)
Other products for "Junctional Adhesion Molecule 2"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | Junctional Adhesion Molecule 2 |
Synonyms | C21orf43; CD322; IBGC8; JAM-B; JAMB; PRO245; VE-JAM; VEJAM |
Vector | pCMV6-Entry |
Sequence Data |
>SC332924 representing NM_001270407.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGGCGAGGAGGAGCCGCCACCGCCTCCTCCTGCTGCTGCTGCGCTACCTGGTGGTCGCCCTGGGCTAT CATAAGGCCTATGGGTTTTCTGCCCCAAAAGACCAACAAGTAGTCACAGCAGTAGAGTACCAAGGTGAT TTTAAAAATCGAGCTGAGATGATAGATTTCAATATCCGGATCAAAAATGTGACAAGAAGTGATGCGGGG AAATATCGTTGTGAAGTTAGTGCCCCATCTGAGCAAGGCCAAAACCTGGAAGAGGATACAGTCACTCTG GAAGTATTAGTGGCTCCAGCAGTTCCATCATGTGAAGTACCCTCTTCTGCTCTGAGTGGAACTGTGGTA GAGCTACGATGTCAAGACAAAGAAGGGAATCCAGCTCCTGAATACACATGGTTTAAGGATGGCATCCGT TTGCTAGAAAATCCCAGACTTGGCTCCCAAAGCACCAACAGCTCATACACAATGAATACAAAAACTGGA ACTCTGCAATTTAATACTGTTTCCAAACTGGACACTGGAGAATATTCCTGTGAAGCCCGCAATTCTGTT GGATATCGCAGGTGTCCTGGGAAACGAATGCAAGTAGATGATCTCAACATAAGTGGCATCATAGCAGCC GTAGTAGTTGTGGCCTTAGTGATTTCCGTTTGTGGCCTTGGTGTATGCTATGCTCAGAGGAAAGGCTAC TTTTCAAAAGAAACCTCCTTCCAGAAGAGTAATTCTTCATCTAAAGCCACGACAATGAGTGAAAATGAT TTCAAGCACACAAAATCCTTTATAATTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001270407 |
Insert Size | 789 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001270407.1 |
RefSeq Size | 4249 bp |
RefSeq ORF | 789 bp |
Locus ID | 58494 |
UniProt ID | P57087 |
Cytogenetics | 21q21.3 |
Protein Families | Druggable Genome, Transmembrane |
Protein Pathways | Cell adhesion molecules (CAMs), Epithelial cell signaling in Helicobacter pylori infection, Leukocyte transendothelial migration, Tight junction |
MW | 29 kDa |
Gene Summary | This gene belongs to the immunoglobulin superfamily, and the junctional adhesion molecule (JAM) family. The protein encoded by this gene is a type I membrane protein that is localized at the tight junctions of both epithelial and endothelial cells. It acts as an adhesive ligand for interacting with a variety of immune cell types, and may play a role in lymphocyte homing to secondary lymphoid organs. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2012] Transcript Variant: This variant (2) lacks an in-frame coding exon compared to variant 1, which results in a shorter isoform (2) missing an internal protein segment compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.