HLA DP (HLA-DPA1) (NM_001242524) Human Untagged Clone

CAT#: SC331822

HLA (untagged) - Homo sapiens major histocompatibility complex, class II, DP alpha 1 (HLA-DPA1), transcript variant 2


  "NM_001242524" in other vectors (2)

Reconstitution Protocol

USD 330.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00


HLA-DPA1 rabbit polyclonal antibody
    • 100 ul

USD 380.00

Other products for "HLA DP"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol HLA DP
Synonyms DP(W3); DP(W4); DPA1; HLA-DP1A; HLA-DPA; HLA-DPB1; HLADP; HLASB; PLT1
Vector pCMV6-Entry
Sequence Data
>SC331822 representing NM_001242524.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGCGCCCTGAAGACAGAATGTTCCATATCAGAGCTGTGATCTTGAGAGCCCTCTCCTTGGCTTTCCTG
CTGAGTCTCCGAGGAGCTGGGGCCATCAAGGCGGACCATGTGTCAACTTATGCCGCGTTTGTACAGACG
CATAGACCAACAGGGGAGTTTATGTTTGAATTTGATGAAGATGAGATGTTCTATGTGGATCTGGACAAG
AAGGAGACCGTCTGGCATCTGGAGGAGTTTGGCCAAGCCTTTTCCTTTGAGGCTCAGGGCGGGCTGGCT
AACATTGCTATATTGAACAACAACTTGAATACCTTGATCCAGCGTTCCAACCACACTCAGGCCACCAAC
GATCCCCCTGAGGTGACCGTGTTTCCCAAGGAGCCTGTGGAGCTGGGCCAGCCCAACACCCTCATCTGC
CACATTGACAAGTTCTTCCCACCAGTGCTCAACGTCACGTGGCTGTGCAACGGGGAGCTGGTCACTGAG
GGTGTCGCTGAGAGCCTCTTCCTGCCCAGAACAGATTACAGCTTCCACAAGTTCCATTACCTGACCTTT
GTGCCCTCAGCAGAGGACTTCTATGACTGCAGGGTGGAGCACTGGGGCTTGGACCAGCCGCTCCTCAAG
CACTGGGAGGCCCAAGAGCCAATCCAGATGCCTGAGACAACGGAGACTGTGCTCTGTGCCCTGGGCCTG
GTGCTGGGCCTAGTCGGCATCATCGTGGGCACCGTCCTCATCATAAAGTCTCTGCGTTCTGGCCATGAC
CCCCGGGCCCAGGGGACCCTGTGA

Restriction Sites SgfI-MluI     
ACCN NM_001242524
Insert Size 783 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001242524.1
RefSeq Size 1788 bp
RefSeq ORF 783 bp
Locus ID 3113
UniProt ID P20036
Cytogenetics 6p21.32
Protein Families Transmembrane
Protein Pathways Allograft rejection, Antigen processing and presentation, Asthma, Autoimmune thyroid disease, Cell adhesion molecules (CAMs), Graft-versus-host disease, Systemic lupus erythematosus, Type I diabetes mellitus, Viral myocarditis
MW 29.4 kDa
Gene Summary HLA-DPA1 belongs to the HLA class II alpha chain paralogues. This class II molecule is a heterodimer consisting of an alpha (DPA) and a beta (DPB) chain, both anchored in the membrane. It plays a central role in the immune system by presenting peptides derived from extracellular proteins. Class II molecules are expressed in antigen presenting cells (APC: B lymphocytes, dendritic cells, macrophages). The alpha chain is approximately 33-35 kDa and its gene contains 5 exons. Exon one encodes the leader peptide, exons 2 and 3 encode the two extracellular domains, exon 4 encodes the transmembrane domain and the cytoplasmic tail. Within the DP molecule both the alpha chain and the beta chain contain the polymorphisms specifying the peptide binding specificities, resulting in up to 4 different molecules. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1, 2 and 3 encode the same protein.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.