RAGE (AGER) (NM_001206934) Human Untagged Clone

CAT#: SC331710

AGER (untagged) - Homo sapiens advanced glycosylation end product-specific receptor (AGER), transcript variant 4


  "NM_001206934" in other vectors (2)

Reconstitution Protocol

USD 503.00

5 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
Rabbit polyclonal AGER Antibody (N-term)
    • 400 ul

USD 580.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "RAGE"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol RAGE
Synonyms RAGE; SCARJ1; sRAGE
Vector pCMV6-Entry
Sequence Data
>SC331710 representing NM_001206934.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGCAGCCGGAACAGCAGTTGGAGCCTGGGTGCTGGTCCTCAGTCTGTGGGGGGCAGTAGTAGGTGCT
CAAAACATCACAGCCCGGATTGGCGAGCCACTGGTGCTGAAGTGTAAGGGGGCCCCCAAGAAACCACCC
CAGCGGCTGGAATGGAAACTGAACACAGGCCGGACAGAAGCTTGGAAGGTCCTGTCTCCCCAGGGAGGA
GGCCCCTGGGACAGTGTGGCTCGTGTCCTTCCCAACGGCTCCCTCTTCCTTCCGGCTGTCGGGATCCAG
GATGAGGGGATTTTCCGGTGCCAGGCAATGAACAGGAATGGAAAGGAGACCAAGTCCAACTACCGAGTC
CGTGTCTACCAGATTCCTGGGAAGCCAGAAATTGTAGATTCTGCCTCTGAACTCACGGCTGGTGTTCCC
AATAAGGTAGTGGAAGAAAGCAGGAGAAGTAGAAAACGGCCCTGTGAACAGGAGGTGGGGACATGTGTG
TCAGAGGGAAGCTACCCTGCAGGGACTCTTAGCTGGCACTTGGATGGGAAGCCCCTGGTGCCTAATGAG
AAGGGAGTATCTGTGAAGGAACAGACCAGGAGACACCCTGAGACAGGGCTCTTCACACTGCAGTCGGAG
CTAATGGTGACCCCAGCCCGGGGAGGAGATCCCCGTCCCACCTTCTCCTGTAGCTTCAGCCCAGGCCTT
CCCCGACACCGGGCCTTGCGCACAGCCCCCATCCAGCCCCGTGTCTGGGAGCCTGTGCCTCTGGAGGAG
GTCCAATTGGTGGTGGAGCCAGAAGGTGGAGCAGTAGCTCCTGGTGGAACCGTAACCCTGACCTGTGAA
GTCCCTGCCCAGCCCTCTCCTCAAATCCACTGGATGAAGGATGGTGTGCCCTTGCCCCTTCCCCCCAGC
CCTGTGCTGATCCTCCCTGAGATAGGGCCTCAGGACCAGGGAACCTACAGCTGTGTGGCCACCCATTCC
AGCCACGGGCCCCAGGAAAGCCGTGCTGTCAGCATCAGCATCATCGAACCAGGCGAGGAGGGGCCAACT
GCAGGTGAGGGGTTTGATAAAGTCAGGGAAGCAGAAGATAGCCCCCAACACATGTGA

Restriction Sites SgfI-MluI     
ACCN NM_001206934
Insert Size 1092 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001206934.1
RefSeq Size 1511 bp
RefSeq ORF 1092 bp
Locus ID 177
UniProt ID Q15109
Cytogenetics 6p21.32
Protein Families Druggable Genome, Secreted Protein, Transmembrane
MW 39 kDa
Gene Summary The advanced glycosylation end product (AGE) receptor encoded by this gene is a member of the immunoglobulin superfamily of cell surface receptors. It is a multiligand receptor, and besides AGE, interacts with other molecules implicated in homeostasis, development, and inflammation, and certain diseases, such as diabetes and Alzheimer's disease. Many alternatively spliced transcript variants encoding different isoforms, as well as non-protein-coding variants, have been described for this gene (PMID:18089847). [provided by RefSeq, May 2011]
Transcript Variant: This variant (4, also known as RAGE_v6) lacks the penultimate coding exon, and uses alternate donor splice sites at two internal coding exons compared to variant 1. This results in a frame-shift and a shorter isoform (4) with a distinct C-terminus compared to isoform 1. Sequence Note: This Refseq, containing two in-frame translation initiation codons (at nt 8-10 and nt 101-103), is annotated with a CDS starting from the downstream AUG (dAUG) because the AGE receptor encoded by this gene is a known type 1 transmembrane protein requiring signal peptide for its function, and a signal peptide of 22 aa is predicted for the dAUG initiated protein. Translation initiation from the upstream AUG (uAUG) will add an extra 31 aa to the N-terminus, and no signal peptide is predicted for the uAUG initiated protein.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.