Prolactin Receptor (PRLR) (NM_001204315) Human Untagged Clone

CAT#: SC331559

PRLR (untagged) - Homo sapiens prolactin receptor (PRLR), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: Prolactin Receptor
• Synonyms: HPRL; hPRLrI; MFAB; RI-PRLR
• Vector: pCMV6-Entry
• Sequence Data:
  Fully Sequenced ORF

  >SC331559 representing NM_001204315.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  ATGAAGGAAAATGTGGCATCTGCAACCGTTTTCACTCTGCTACTTTTTCTCAACACCTGCCTTCTGAAT
  GGACAGTTACCTCCTGGAAAACCTGAGATCTTTAAATGTCGTTCTCCCAATAAGGAAACATTCACCTGC
  TGGTGGAGGCCTGGGACAGATGGAGGACTTCCTACCAATTATTCACTGACTTACCACAGGGAAGGAGAG
  ACACTCATGCATGAATGTCCAGACTACATAACCGGTGGCCCCAACTCCTGCCACTTTGGCAAGCAGTAC
  ACCTCCATGTGGAGGACATACATCATGATGGTCAATGCCACTAACCAGATGGGAAGCAGTTTCTCGGAT
  GAACTTTATGTGGACGTGACTTACATAGTTCAGCCAGACCCTCCTTTGGAGCTGGCTGTGGAAGTAAAA
  CAGCCAGAAGACAGAAAACCCTACCTGTGGATTAAATGGTCTCCACCTACCCTGATTGACTTAAAAACT
  GGTTGGTTCACGCTCCTGTATGAAATTCGATTAAAACCCGAGAAAGCAGCTGAGTGGGAGATCCATTTT
  GCTGGGCAGCAAACAGAGTTTAAGATTCTCAGCCTACATCCAGGACAGAAATACCTTGTCCAGGTTCGC
  TGCAAACCAGACCATGGATACTGGAGTGCATGGAGTCCAGCGACCTTCATTCAGATACCTAGTGACTTC
  ACCATGAATGATACAACCGTGTGGATCTCTGTGGCTGTCCTTTCTGCTGTCATCTGTTTGATTATTGTC
  TGGGCAGTGGCTTTGAAGGGCTATAGCATGGTGACCTGCATCTTTCCGCCAGTTCCTGGGCCAAAAATA
  AAAGGATTTGATGCTCATCTGTTGGAGAAGGGCAAGTCTGAAGAACTACTGAGTGCCTTGGGATGCCAA
  GACTTTCCTCCCACTTCTGACTATGAGGACTTGCTGGTGGAGTATTTAGAAGTAGATGATAGTGAGGAC
  CAGCATCTAATGTCAGTCCATTCAAAAGAACACCCAAGTCAAGAGAGAGAACAGCGGCAAGCCCAAGAA
  GCCCGGGACTCCTGA
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001204315
• Insert Size: 1050 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001204315.1
• RefSeq Size: 1402 bp
• RefSeq ORF: 1050 bp
• Locus ID: 5618
• UniProt ID: P16471
• Cytogenetics: 5p13.2
• Protein Families: Druggable Genome, Transmembrane
• Protein Pathways: Cytokine-cytokine receptor interaction, Jak-STAT signaling pathway, Neuroactive ligand-receptor interaction
• MW: 39.8 kDa
• Gene Summary: This gene encodes a receptor for the anterior pituitary hormone, prolactin, and belongs to the type I cytokine receptor family. Prolactin-dependent signaling occurs as the result of ligand-induced dimerization of the prolactin receptor. Several alternatively spliced transcript variants encoding different membrane-bound and soluble isoforms have been described for this gene, which may function to modulate the endocrine and autocrine effects of prolactin in normal tissue and cancer. [provided by RefSeq, Feb 2011]
  Transcript Variant: This variant (2) is alternatively spliced at the 3' end compared to variant 1. This results in a frame-shift and a shorter isoform (2, also known as intermediate form) with a distinct C-terminus compared to isoform 1. This isoform is functional, but has different tissue specific expression and signaling pattern from isoform 1 (PMID:10585417).