ELOVL1 (NM_001256402) Human Untagged Clone
CAT#: SC330415
ELOVL1 (untagged) - Homo sapiens ELOVL fatty acid elongase 1 (ELOVL1), transcript variant 4
"NM_001256402" in other vectors (2)
Product Images
Frequently bought together (4)
Other products for "ELOVL1"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | ELOVL1 |
Synonyms | CGI-88; IKSHD; Ssc1 |
Vector | pCMV6-Entry |
Sequence Data |
>SC330415 representing NM_001256402.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGTCGGGCTGGCTGAGCACCTATACCTGGCGCTGTGACCCTGTGGACTATTCCAACAGCCCTGAGGCA CTTAGGATGGTTCGGGTGGCCTGGCTCTTCCTCTTCTCCAAGTTCATTGAGCTGATGGACACAGTGATC TTTATTCTCCGAAAGAAAGACGGGCAGGTGACCTTCCTACATGTCTTCCATCACTCTGTGCTTCCCTGG AGCTGGTGGTGGGGGGTAAAGATTGCCCCGGGAGGAATGGGCTCTTTCCATGCCATGATAAACTCTTCC GTGCATGTCATAATGTACCTGTACTACGGATTATCTGCCTTTGGCCCTGTGGCACAACCCTACCTTTGG TGGAAAAAGCACATGACAGCCATTCAGCTGATCCAGTTTGTCCTGGTCTCACTGCACATCTCCCAGTAC TACTTTATGTCCAGCTGTAACTACCAGTACCCAGTCATTATTCACCTCATCTGGATGTATGGCACCATC TTCTTCATGCTGTTCTCCAACTTCTGGTATCACTCTTATACCAAGGGCAAGCGGCTGCCCCGTGCACTT CAGCAAAATGGAGCTCCAGGTATTGCCAAGGTCAAGGCCAACTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001256402 |
Insert Size | 597 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001256402.1 |
RefSeq Size | 1347 bp |
RefSeq ORF | 597 bp |
Locus ID | 64834 |
UniProt ID | Q9BW60 |
Cytogenetics | 1p34.2 |
Protein Families | Transmembrane |
MW | 23.3 kDa |
Gene Summary | Catalyzes the first and rate-limiting reaction of the four reactions that constitute the long-chain fatty acids elongation cycle. This endoplasmic reticulum-bound enzymatic process allows the addition of 2 carbons to the chain of long- and very long-chain fatty acids (VLCFAs) per cycle. Condensing enzyme that exhibits activity toward saturated and monounsaturated acyl-CoA substrates, with the highest activity towards C22:0 acyl-CoA. May participate in the production of both saturated and monounsaturated VLCFAs of different chain lengths that are involved in multiple biological processes as precursors of membrane lipids and lipid mediators. Important for saturated C24:0 and monounsaturated C24:1 sphingolipid synthesis. Indirectly inhibits RPE65 via production of VLCFAs.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (4) lacks an alternate exon which results in the use of a downstream start codon, compared to variant 1. The resulting protein (isoform 3) is shorter when it is compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.