CED6 (GULP1) (NM_001252668) Human Untagged Clone

CAT#: SC330292

GULP1 (untagged) - Homo sapiens GULP, engulfment adaptor PTB domain containing 1 (GULP1), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CED6
• Synonyms: CED-6; CED6; GULP
• Vector: pCMV6-Entry
• Sequence Data:
  Fully Sequenced ORF

  >SC330292 representing NM_001252668.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  ATGAACCGTGCTTTTAGCAGGAAGAAAGACAAAACATGGATGCATACACCTGAAGCTTTATCAAAACAT
  TTCATTCCCTATAATGCAAAGTTTCTTGGCAGTACAGAAGTGGAACAGCCAAAAGGAACAGAAGTTGTG
  AGAGATGCTGTAAGGAAACTAAAGTTTGCAAGACATATCAAGAAATCTGAAGGCCAGAAAATTCCTAAA
  GTGGAGTTGCAAATATCAATTTATGGAGTAAAAATTCTAGAACCCAAAACAAAGGAAGTTCAACACAAT
  TGCCAGCTTCATAGAATATCTTTTTGTGCAGATGATAAAACTGACAAGAGGATATTCACTTTCATATGC
  AAAGATTCTGAGTCAAATAAACATTTGTGCTATGTATTTGACAGCGAAAAGTGTGCTGAAGAGATCACT
  TTAACAATTGGCCAAGCATTTGACCTGGCATACAGGAAATTTCTAGAATCAGGAGGAAAAGATGTTGAA
  ACAAGAAAACAGATCGCAGGGTTACAAAAAAGAATCCAAGACTTAGAAACAGAAAATATGGAACTTAAA
  AATAAAGTACAAGATTTGGAAAACCAACTGAGAATAACTCAAGTATCAGCACCTCCAGCAGGCAGTATG
  ACACCTAAGTCGCCCTCCACTGACATCTTTGATATGATTCCATTTTCTCCAATATCACACCAGTCTTCG
  ATGCCTACTCGCAATGGCACACAGCCACCTCCAGTACCTAGTAGATCTACTGAGATTAAACGGGACCTG
  TTTGGAGCAGAACCTTTTGACCCATTTAACTGTGGAGCAGCAGATTTCCCTCCAGATATTCAATCAAAA
  TTAGATGAGATGCAGCGCCAGAGATGGAGGGGTTCAAAATGGGACTAA
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001252668
• Insert Size: 876 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001252668.1
• RefSeq Size: 3523 bp
• RefSeq ORF: 876 bp
• Locus ID: 51454
• UniProt ID: Q9UBP9
• Cytogenetics: 2q32.1-q32.2
• Protein Families: Druggable Genome
• MW: 33.3 kDa
• Gene Summary: The protein encoded by this gene is an adapter protein necessary for the engulfment of apoptotic cells by phagocytes. Several transcript variants, some protein coding and some thought not to be protein coding, have been found for this gene. [provided by RefSeq, Nov 2011]
  Transcript Variant: This variant (2) contains an alternate exon in the 3' end, that causes a frameshift. The resulting isoform (b) has a shorter and distinct C-terminus compared to isoform a.