hCG (CGA) (NM_001252383) Human Untagged Clone
CAT#: SC330286
CGA (untagged) - Homo sapiens glycoprotein hormones, alpha polypeptide (CGA), transcript variant 1
"NM_001252383" in other vectors (2)
Product Images
Frequently bought together (3)
Other products for "hCG"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | hCG |
Synonyms | CG-ALPHA; FSHA; GPA1; GPHa; GPHA1; HCG; LHA; TSHA |
Vector | PCMV6-Neo |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001252383, the custom clone sequence may differ by one or more nucleotides
ATGGATTACTACAGAAAATATGCAGCTATCTTTCTGGTCACATTGTCGGTGTTTCTGCATGTTCTCCATT CCGCTCCTGATGTGCAGGAGACAGGGTTTCACCATGTTGCCCAGGCTGCTCTCAAACTCCTGAGCTCAAG CAATCCACCCACTAAGGCCTCCCAAAGTGCTAGGATTACAGATTGCCCAGAATGCACGCTACAGGAAAAC CCATTCTTCTCCCAGCCGGGTGCCCCAATACTTCAGTGCATGGGCTGCTGCTTCTCTAGAGCATATCCCA CTCCACTAAGGTCCAAGAAGACGATGTTGGTCCAAAAGAACGTCACCTCAGAGTCCACTTGCTGTGTAGC TAAATCATATAACAGGGTCACAGTAATGGGGGGTTTCAAAGTGGAGAACCACACGGCGTGCCACTGCAGT ACTTGTTATTATCACAAATCTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001252383 |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001252383.1, NP_001239312.1 |
RefSeq Size | 861 bp |
RefSeq ORF | 444 bp |
Locus ID | 1081 |
UniProt ID | P01215 |
Cytogenetics | 6q14.3 |
Protein Families | Druggable Genome, ES Cell Differentiation/IPS, Secreted Protein |
Protein Pathways | Autoimmune thyroid disease, GnRH signaling pathway, Neuroactive ligand-receptor interaction |
Gene Summary | The four human glycoprotein hormones chorionic gonadotropin (CG), luteinizing hormone (LH), follicle stimulating hormone (FSH), and thyroid stimulating hormone (TSH) are dimers consisting of alpha and beta subunits that are associated noncovalently. The alpha subunits of these hormones are identical, however, their beta chains are unique and confer biological specificity. The protein encoded by this gene is the alpha subunit and belongs to the glycoprotein hormones alpha chain family. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011] Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.