ELOVL5 (NM_001242828) Human Untagged Clone

CAT#: SC330024

ELOVL5 (untagged) - Homo sapiens ELOVL fatty acid elongase 5 (ELOVL5), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: ELOVL5
• Synonyms: dJ483K16.1; HELO1; SCA38
• Vector: pCMV6-Entry
• Sequence Data:
  Fully Sequenced ORF

  >SC330024 representing NM_001242828.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  ATGGAACATTTTGATGCATCACTTAGTACCTATTTCAAGGCATTGCTAGGCCCTCGAGATACTAGAGTA
  AAAGGATGGTTTCTTCTGGACAATTATATACCCACATTTATCTGCTCTGTCATATATTTACTAATTGTA
  TGGCTGGGACCAAAATACATGAGGAATAAACAGCCATTCTCTTGCCGGGGGATTTTAGTGGTGTATAAC
  CTTGGACTCACACTGCTGTCTCTGTATATGTTCTGTGAGTCCAAAAGGGAGCAACCCCGTCGATCTGCC
  TGTGCCTCACGAACTGATCCTTCGACTCAGCAGCAGCTGCCAGAAAACAGGTTAGTAACAGGAGTATGG
  GAAGGCAAATACAACTTCTTCTGTCAGGGCACACGCACCGCAGGAGAATCAGATATGAAGATTATCCGT
  GTCCTCTGGTGGTACTACTTCTCCAAACTCATAGAATTTATGGACACTTTCTTCTTCATCCTGCGCAAG
  AACAACCACCAGATCACGGTCCTGCACGTCTACCACCATGCCTCGATGCTGAACATCTGGTGGTTTGTG
  ATGAACTGGGTCCCCTGCGGCCACTCTTATTTTGGTGCCACACTTAATAGCTTCATCCACGTCCTCATG
  TACTCTTACTATGGTTTGTCGTCAGTCCCTTCCATGCGTCCATACCTCTGGTGGAAGAAGTACATCACT
  CAGGGGCAGCTGCTTCAGTTTGTGCTGACAATCATCCAGACCAGCTGCGGGGTCATCTGGCCGTGCACA
  TTCCCTCTTGGTTGGTTGTATTTCCAGATTGGATACATGATTTCCCTGATTGCTCTCTTCACAAACTTC
  TACATTCAGACCTACAACAAGAAAGGGGCCTCCCGAAGGAAAGACCACCTGAAGGACCACCAGAATGGG
  TCCATGGCTGCTGTGAATGGACACACCAACAGCTTTTCACCCCTGGAAAACAATGTGAAGCCAAGGAAG
  CTGCGGAAGGATTGA
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001242828
• Insert Size: 981 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001242828.1
• RefSeq Size: 3119 bp
• RefSeq ORF: 981 bp
• Locus ID: 60481
• UniProt ID: Q9NYP7
• Cytogenetics: 6p12.1
• Protein Families: Transmembrane
• Protein Pathways: Biosynthesis of unsaturated fatty acids
• MW: 38.4 kDa
• Gene Summary: This gene belongs to the ELO family. It is highly expressed in the adrenal gland and testis, and encodes a multi-pass membrane protein that is localized in the endoplasmic reticulum. This protein is involved in the elongation of long-chain polyunsaturated fatty acids. Mutations in this gene have been associated with spinocerebellar ataxia-38 (SCA38). Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2014]
  Transcript Variant: This variant (2) contains an additional in-frame coding exon compared to variant 1. The resulting isoform (2) is longer with an internal protein segment of 27 aa that is not found in isoform 1.