TMEM147 (NM_001242597) Human Untagged Clone

CAT#: SC329990

TMEM147 (untagged) - Homo sapiens transmembrane protein 147 (TMEM147), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: TMEM147
• Synonyms: NIFIE14
• Vector: pCMV6-Entry
• Sequence Data:
  Fully Sequenced ORF

  >SC329990 representing NM_001242597.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  ATGCTGTTCTTGGCCACTTTCTTTCCCACCTGGGAAGGCGGCATCTATGACTTCATTGGGGAGTTCATG
  AAGGCCAGCGTGGATGTGGCAGACCTGATAGGTCTAAACCTTGTCATGTCCCGGAATGCCGGCAAGGGA
  GAGTACAAGATCATGGTTGCTGCCCTGGGCTGGGCCACTGCTGAGCTTATTATGTCCCGCTGCATTCCC
  CTATGGGTCGGAGCCCGGGGCATTGAGTTTGACTGGAAGTACATCCAGATGAGCATAGACTCCAACATC
  AGTCTGGTCCATTACATCGTCGCGTCTGCTCAGGTCTGGATGATAACACGCTATGATCTGTACCACACC
  TTCCGGCCAGCTGTCCTCCTGCTGATGTTCCTCAGTGTCTACAAGGCCTTTGTTATGGAGACCTTCGTC
  CACCTCTGCTCGCTGGGCAGTTGGGCAGCTCTACTGGCCCGAGCAGTGGTAACGGGGCTGCTGGCCCTC
  AGCACTTTGGCCCTGTATGTCGCCGTTGTCAATGTGCACTCCTAG
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001242597
• Insert Size: 528 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001242597.1
• RefSeq Size: 980 bp
• RefSeq ORF: 528 bp
• Locus ID: 10430
• UniProt ID: Q9BVK8
• Cytogenetics: 19q13.12
• Protein Families: Druggable Genome, GPCR, Transmembrane
• MW: 19.5 kDa
• Gene Summary: Acts as a negative regulator of CHRM3 function, most likely by interfering with its trafficking to the cell membrane (PubMed:21056967). Negatively regulates CHRM3-mediated calcium mobilization and activation of RPS6KA1/p90RSK activity (PubMed:21056967).[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (2) lacks a splice site in the 5' coding region and initiates translation at a downstream, in-frame start codon, compared to variant 1. The encoded isoform (2) has a shorter N-terminus, compared to isoform 1.