CD19 (NM_001178098) Human Untagged Clone

CAT#: SC328905

CD19 (untagged)-Human CD19 molecule (CD19) transcript variant 1


  "NM_001178098" in other vectors (6)

Reconstitution Protocol

USD 779.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (3)
CD19 mouse monoclonal antibody, clone OTI3B10
    • 100 ul

USD 478.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "CD19"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CD19
Synonyms B4; CVID3
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_001178098 edited
AGGCCCCTGCCTGCCCCAGCATCCCCTGCGCGAAGCTGGGTGCCCCGGAGAGTCTGACCA
CCATGCCACCTCCTCGCCTCCTCTTCTTCCTCCTCTTCCTCACCCCCATGGAAGTCAGGC
CCGAGGAACCTCTAGTGGTGAAGGTGGAAGAGGGAGATAACGCTGTGCTGCAGTGCCTCA
AGGGGACCTCAGATGGCCCCACTCAGCAGCTGACCTGGTCTCGGGAGTCCCCGCTTAAAC
CCTTCTTAAAACTCAGCCTGGGGCTGCCAGGCCTGGGAATCCACATGAGGCCCCTGGCCA
TCTGGCTTTTCATCTTCAACGTCTCTCAACAGATGGGGGGCTTCTACCTGTGCCAGCCGG
GGCCCCCCTCTGAGAAGGCCTGGCAGCCTGGCTGGACAGTCAATGTGGAGGGCAGCGGGG
AGCTGTTCCGGTGGAATGTTTCGGACCTAGGTGGCCTGGGCTGTGGCCTGAAGAACAGGT
CCTCAGAGGGCCCCAGCTCCCCTTCCGGGAAGCTCATGAGCCCCAAGCTGTATGTGTGGG
CCAAAGACCGCCCTGAGATCTGGGAGGGAGAGCCTCCGTGTCTCCCACCGAGGGACAGCC
TGAACCAGAGCCTCAGCCAGGACCTCACCATGGCCCCTGGCTCCACACTCTGGCTGTCCT
GTGGGGTACCCCCTGACTCTGTGTCCAGGGGCCCCCTCTCCTGGACCCATGTGCACCCCA
AGGGGCCTAAGTCATTGCTGAGCCTAGAGCTGAAGGACGATCGCCCGGCCAGAGATATGT
GGGTAATGGAGACGGGTCTGTTGTTGCCCCGGGCCACAGCTCAAGACGCTGGAAAGTATT
ATTGTCACCGTGGCAACCTGACCATGTCATTCCACCTGGAGATCACTGCTCGGCCAGTAC
TATGGCACTGGCTGCTGAGGACTGGTGGCTGGAAGGTCTCAGCTGTGACTTTGGCTTATC
TGATCTTCTGCCTGTGTTCCCTTGTGGGCATTCTTCATCTTCAAAGAGCCCTGGTCCTGA
GGAGGAAAAGAAAGCGAATGACTGACCCCACCAGGAGATTCTTCAAAGTGACGCCTCCCC
CAGGAAGCGGGCCCCAGAACCAGTACGGGAACGTGCTGTCTCTCCCCACACCCACCTCAG
GCCTCGGACGCGCCCAGCGTTGGGCCGCAGGCCTGGGGGGCACTGCCCCGTCTTATGGAA
ACCCGAGCAGCGACGTCCAGGCGGATGGAGCCTTGGGGTCCCGGAGCCCGCCGGGAGTGG
GCCCAGAAGAAGAGGAAGGGGAGGGCTATGAGGAACCTGACAGTGAGGAGGACTCCGAGT
TCTATGAGAACGACTCCAACCTTGGGCAGGACCAGCTCTCCCAGGATGGCAGCGGCTACG
AGAACCCTGAGGATGAGCCCCTGGGTCCTGAGGATGAAGACTCCTTCTCCAACGCTGAGT
CTTATGAGAACGAGGATGAAGAGCTGACCCAGCCGGTCGCCAGGACAATGGACTTCCTGA
GCCCTCATGGGTCAGCCTGGGACCCCAGCCGGGAAGCAACCTCCCTGGCAGGGTCCCAGT
CCTATGAGGATATGAGAGGAATCCTGTATGCAGCCCCCCAGCTCCGCTCCATTCGGGGCC
AGCCTGGACCCAATCATGAGGAAGATGCAGACTCTTATGAGAACATGGATAATCCCGATG
GGCCAGACCCAGCCTGGGGAGGAGGGGGCCGCATGGGCACCTGGAGCACCAGGTGATCCT
CAGGTGGCCAGCCTGGATCTCCTCAAGTCCCCAAGATTCACACCTGACTCTGAAATCTGA
AGACCTCGAC
Restriction Sites Please inquire     
ACCN NM_001178098
Insert Size 1800 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_001178098.1.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001178098.1, NP_001171569.1
RefSeq Size 1968 bp
RefSeq ORF 1674 bp
Locus ID 930
UniProt ID P15391
Cytogenetics 16p11.2
Protein Families Druggable Genome, Transmembrane
Protein Pathways B cell receptor signaling pathway, Hematopoietic cell lineage, Primary immunodeficiency
Gene Summary This gene encodes a member of the immunoglobulin gene superfamily. Expression of this cell surface protein is restricted to B cell lymphocytes. This protein is a reliable marker for pre-B cells but its expression diminishes during terminal B cell differentiation in antibody secreting plasma cells. The protein has two N-terminal extracellular Ig-like domains separated by a non-Ig-like domain, a hydrophobic transmembrane domain, and a large C-terminal cytoplasmic domain. This protein forms a complex with several membrane proteins including complement receptor type 2 (CD21) and tetraspanin (CD81) and this complex reduces the threshold for antigen-initiated B cell activation. Activation of this B-cell antigen receptor complex activates the phosphatidylinositol 3-kinase signalling pathway and the subsequent release of intracellular stores of calcium ions. This protein is a target of chimeric antigen receptor (CAR) T-cells used in the treatment of lymphoblastic leukemia. Mutations in this gene are associated with the disease common variable immunodeficiency 3 (CVID3) which results in a failure of B-cell differentiation and impaired secretion of immunoglobulins. CVID3 is characterized by hypogammaglobulinemia, an inability to mount an antibody response to antigen, and recurrent bacterial infections. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2020]
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.