AMACR (NM_001167595) Human Untagged Clone

CAT#: SC328627

AMACR (untagged)-Human alpha-methylacyl-CoA racemase (AMACR) nuclear gene encoding mitochondrial protein transcript variant 3


  "NM_001167595" in other vectors (6)

Reconstitution Protocol

USD 686.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (3)
AMACR mouse monoclonal antibody,clone OTI5F10
    • 100 ul

USD 447.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "AMACR"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol AMACR
Synonyms AMACRD; CBAS4; P504S; RACE; RM
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC328627 representing NM_001167595
Red=Cloning site Blue=ORF

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCACTGCAGGGCATCTCGGTCGTGGAGCTGTCCGGCCTGGCCCCGGGCCCGTTCTGTGCTATGGTCC
TGGCTGACTTCGGGGCGCGTGTGGTACGCGTGGACCGGCCCGGCTCCCGCTACGACGTGAGCCGCTTGGG
CCGGGGCAAGCGCTCGCTAGTGCTGGACCTGAAGCAGCCGCGGGGAGCCGCCGTGCTGCGGCGTCTGTGC
AAGCGGTCGGATGTGCTGCTGGAGCCCTTCCGCCGCGGTGTCATGGAGAAACTCCAGCTGGGCCCAGAGA
TTCTGCAGCGGGAAAATCCAAGGCTTATTTATGCCAGGCTGAGTGGATTTGGCCAGTCAGGAAGCTTCTG
CCGGTTAGCTGGCCACGATATCAACTATTTGGCTTTGTCAGGTGTTCTCTCAAAAATTGGCAGAAGTGGT
GAGAATCCGTATGCCCCGCTGAATCTCCTGGCTGACTTTGCTGGTGGTGGCCTTATGTGTGCACTGGGCA
TTATAATGGCTCTTTTTGACCGCACACGCACTGGCAAGGGTCAGGTCATTGATGCAAATATGGTGGAAGG
AACAGCATATTTAAGTTCTTTTCTGTGGAAAACTCAGAAATTGAGTCTGTGGGAAGCACCTCGAGGACAG
AACATGTTGGATGGTGGAGCACCTTTCTATACGACTTACAGGACAGCAGATGGGGAATTCATGGCTGTTG
GAGCAATAGAACCCCAGTTCTACGAGCTGCTGATCAAAGGACTTGGACTAAAGTCTGATGAACTTCCCAA
TCAGATGAGCATGGATGATTGGCCAGAAATGAAGAAGAAGTTTGCAGATGTATTTGCAGAGAAGACGAAG
GCAGAGTGGTGTCAAATCTTTGACGGCACAGATGCCTGTGTGACTCCGGTTCTGACTTTTGAGGAGGTTG
TTCATCATGATCACAACAAGGAACGGGGCTCGTTTATCACCAGTGAGGAGCAGGACGTGAGCCCCCGCCC
TGCACCTCTGCTGTTAAACACCCCAGCCATCCCTTCTTTCAAAAGGGATCCTTTCATAGGAGAACACACT
GAGGAGATACTTGAAGAATTTGGATTCAGCCGCGAAGAGATTTATCAGCTTAACTCAGATAAAATCATTG
AAAGTAATAAGGCTGGTAGCAAGTTCTGGATCTTATACCCAACACACAGCAACATCCAGAAATAAAGCGG
ACCG


AGCGGACCGACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCC
TGGATTACAAGGATGACGACGATAAGGTTTAA
Restriction Sites Please inquire     
ACCN NM_001167595
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001167595.1, NP_001161067.1
RefSeq Size 2603 bp
RefSeq ORF 1185 bp
Locus ID 23600
UniProt ID Q9UHK6
Cytogenetics 5p13.2
Protein Families Druggable Genome
Protein Pathways Metabolic pathways, Primary bile acid biosynthesis
Gene Summary This gene encodes a racemase. The encoded enzyme interconverts pristanoyl-CoA and C27-bile acylCoAs between their (R)- and (S)-stereoisomers. The conversion to the (S)-stereoisomers is necessary for degradation of these substrates by peroxisomal beta-oxidation. Encoded proteins from this locus localize to both mitochondria and peroxisomes. Mutations in this gene may be associated with adult-onset sensorimotor neuropathy, pigmentary retinopathy, and adrenomyeloneuropathy due to defects in bile acid synthesis. Alternatively spliced transcript variants have been described. Read-through transcription also exists between this gene and the upstream neighboring C1QTNF3 (C1q and tumor necrosis factor related protein 3) gene. [provided by RefSeq, Mar 2011]
Transcript Variant: This variant (3) lacks an alternate segment in the 3' end of the CDS, which results in a frameshift, compared to variant 1. The resulting protein (isoform 3) is longer and has a distinct C-terminus, compared to isoform 1. This isoform is also referred to as AMACRIADEL.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.