Claudin 10 (CLDN10) (NM_001160100) Human Untagged Clone

CAT#: SC326772

CLDN10 (untagged)-Human claudin 10 (CLDN10) transcript variant a_v1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: Claudin 10
• Synonyms: CPETRL3; HELIX; OSP-L; OSPL
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC326772 representing NM_001160100.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGTCCAGGGCGCAGATCTGGGCTCTGGTGTCTGGTGTCGGAGGGTTTGGAGCTCTCGTTGCTGCTACC
  ACGTCCAATGAGTGGAAAGTGACCACGCGAGCCTCCTCGGTGATAACAGCCACTTGGGTTTACCAGGGT
  CTGTGGATGAACTGCGCAGGTTATATACAGGCATGTAGAGGACTTATGATCGCTGCTGTCAGCCTGGGC
  TTCTTTGGTTCCATATTTGCGCTCTTTGGAATGAAGTGTACCAAAGTCGGAGGCTCCGATAAAGCCAAA
  GCTAAAATTGCTTGTTTGGCTGGGATTGTATTCATACTGTCAGGGCTGTGCTCAATGACTGGATGTTCC
  CTATATGCAAACAAAATCACAACGGAATTCTTTGATCCTCTCTTTGTTGAGCAAAAGTATGAATTAGGA
  GCCGCTCTGTTTATTGGATGGGCAGGAGCCTCACTGTGCATAATTGGTGGTGTCATATTTTGCTTTTCA
  ATATCTGACAACAACAAAACACCCAGATACACATACAACGGGGCCACATCTGTCATGTCTTCTCGGACA
  AAGTATCATGGTGGAGAAGATTTTAAAACAACAAACCCTTCAAAACAGTTTGATAAAAATGCTTATGTC
  TAA
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001160100
• Insert Size: 624 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001160100.1
• RefSeq Size: 2601 bp
• RefSeq ORF: 624 bp
• Locus ID: 9071
• UniProt ID: P78369
• Cytogenetics: 13q32.1
• Protein Families: Transmembrane
• Protein Pathways: Cell adhesion molecules (CAMs), Leukocyte transendothelial migration, Tight junction
• MW: 22.2 kDa
• Gene Summary: This gene encodes a member of the claudin family. Claudins are integral membrane proteins and components of tight junction strands. Tight junction strands serve as a physical barrier to prevent solutes and water from passing freely through the paracellular space between epithelial or endothelial cell sheets, and also play critical roles in maintaining cell polarity and signal transductions. The expression level of this gene is associated with recurrence of primary hepatocellular carcinoma. Six alternatively spliced transcript variants encoding different isoforms have been reported, but the transcript sequences of some variants are not determined.[provided by RefSeq, Jun 2010]
  Transcript Variant: This variant (a_v1) uses an alternate in-frame splice site in the 5' coding region, compared to variant a. The resulting isoform (a_i1) lacks an internal segment near the N-terminus, compared to isoform a.