CKII alpha (CSNK2A1) (NM_177559) Human Untagged Clone

CAT#: SC323516

CSNK2A1 (untagged)-Kinase deficient mutant (K68M) of Human casein kinase 2, alpha 1 polypeptide (CSNK2A1), transcript variant 1


  "NM_177559" in other vectors (5)

Reconstitution Protocol

USD 686.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (3)
Anti-CSNK2A1 Rabbit Polyclonal Antibody
    • 100 ul

USD 380.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "CKII alpha"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CKII alpha
Synonyms CK2A1; Cka1; Cka2; CKII; OCNDS
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_177559, the custom clone sequence may differ by one or more nucleotides


ATGTCGGGACCCGTGCCAAGCAGGGCCAGAGTTTACACAGATGTTAATACACACAGACCTCGAGAATACT
GGGATTACGAGTCACATGTGGTGGAATGGGGAAATCAAGATGACTACCAGCTGGTTCGAAAATTAGGCCG
AGGTAAATACAGTGAAGTATTTGAAGCCATCAACATCACAAATAATGAAAAAGTTGTTGTTAAAATTCTC
AAGCCAGTAAAAAAGAAGAAAATTAAGCGTGAAATAAAGATTTTGGAGAATTTGAGAGGAGGTCCCAACA
TCATCACACTGGCAGACATTGTAAAAGACCCTGTGTCACGAACCCCCGCCTTGGTTTTTGAACACGTAAA
CAACACAGACTTCAAGCAATTGTACCAGACGTTAACAGACTATGATATTCGATTTTACATGTATGAGATT
CTGAAGGCCCTGGATTATTGTCACAGCATGGGAATTATGCACAGAGATGTCAAGCCCCATAATGTCATGA
TTGATCATGAGCACAGAAAGCTACGACTAATAGACTGGGGTTTGGCTGAGTTTTATCATCCTGGCCAAGA
ATATAATGTCCGAGTTGCTTCCCGATACTTCAAAGGTCCTGAGCTACTTGTAGACTATCAGATGTACGAT
TATAGTTTGGATATGTGGAGTTTGGGTTGTATGCTGGCAAGTATGATCTTTCGGAAGGAGCCATTTTTCC
ATGGACATGACAATTATGATCAGTTGGTGAGGATAGCCAAGGTTCTGGGGACAGAAGATTTATATGACTA
TATTGACAAATACAACATTGAATTAGATCCACGTTTCAATGATATCTTGGGCAGACACTCTCGAAAGCGA
TGGGAACGCTTTGTCCACAGTGAAAATCAGCACCTTGTCAGCCCTGAGGCCTTGGATTTCCTGGACAAAC
TGCTGCGATATGACCACCAGTCACGGCTTACTGCAAGAGAGGCAATGGAGCACCCCTATTTCTACACTGT
TGTGAAGGACCAGGCTCGAATGGGTTCATCTAGCATGCCAGGGGGCAGTACGCCCGTCAGCAGCGCCAAT
ATGATGTCAGGGATTTCTTCAGTGCCAACCCCTTCACCCCTTGGACCTCTGGCAGGCTCACCAGTGATTG
CTGCTGCCAACCCCCTTGGGATGCCTGTTCCAGCTGCCGCTGGCGCTCAGCAGTAA


>OriGene 5' read for mutant NM_177559 unedited
ACGCCCGTAGAGCAATGGGCGGTAGGCGCTGTACGGTGGGAGGTCTATATAAGCAGAGCTCGTTTAGTGA
ACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGCGAATTCGGCACGAGGGTCTCCTCCTCCA
TCGCCGCCATATTGTCTGTGTGAGCAGAGGGGAGAGCGGCCGCCGCCGCTGCCGCTTCCACCACAGCTCT
ATCAAGGCTTGTCAAGCAGTGTGCTCATCACATGGTAAATCATGCAGCGTGGAACCTCATAAAATCTCCA
AGAAACATCATTCACCCATACTGACTAGTTTCACATCTCTTTGTTTGAAGAAAAACAGGTCTGAAAACAA
GGTCTAACCCCCAGCTGCTTCTGAACACAGTGACTGCCAGAATCTCCAAACATCAAGTCCCAGCTTTGTC
CGCCAACCGGTCTGACTGGTCGGAACCCGTGCAAGCAGGGCCAGAGTTTACCCAGTGTTAATCCCCCACC
CTCGAAAACCTGGAATACAGTTCCAGGTGTGGATTGGGAAATCAAAGGATACACTGGTTCAAATTAGCAG
AGTACTCGTGGATTTTTGACCCCCCAAACACATAAAAA
>SC323516 kinase domain raw sequence. By performing BLASTX analysis with this sequence against NCBI refernce protein database, you can confirm the presence of the kinase-deficient mutation
TGATCGAATTATGCCGAGKAATACAGTGAAGTATTTGAAGCCATCAACATCACAAATAATGAAAAAGTTG
TTGTTATGATTCTCAAGCCAGTAAAAAAGAAGAAAATTAAGCGTGAAATAAAGATTTTGGAGAATTTGAG
AGGAGGTCCCAACATCATCACACTGGCAGACATTGTAAAAGACCCTGTGTCACGAACCCCCGCCTTGGTT
TTTGAACACGTAAACAACACAGACTTCAAGCAATTGTACCAGACG
Restriction Sites Please inquire     
ACCN NM_177559
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This kinase-deficient mutant clone was generated by created by site-directed mutagenesis from the corresponding wild-type clone. See details in "Application of active and kinase-deficient kinome collection for identification of kinases regulating hedgehog signaling." Cell. 2008 May p536-548.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_177559.2, NP_808227.1
RefSeq Size 2849 bp
RefSeq ORF 1176 bp
Locus ID 1457
UniProt ID P68400
Cytogenetics 20p13
Protein Families Druggable Genome, ES Cell Differentiation/IPS, Protein Kinase
Protein Pathways Adherens junction, Tight junction, Wnt signaling pathway
Gene Summary Casein kinase II is a serine/threonine protein kinase that phosphorylates acidic proteins such as casein. It is involved in various cellular processes, including cell cycle control, apoptosis, and circadian rhythm. The kinase exists as a tetramer and is composed of an alpha, an alpha-prime, and two beta subunits. The alpha subunits contain the catalytic activity while the beta subunits undergo autophosphorylation. The protein encoded by this gene represents the alpha subunit. Multiple transcript variants encoding different protein isoforms have been found for this gene. [provided by RefSeq, Apr 2018]
Transcript Variant: This variant (1) encodes the longer isoform (a). Variants 1, 2, 4 and 5 encode the same protein.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.