MSRB3 (NM_001031679) Human Untagged Clone

CAT#: SC321838

MSRB3 (untagged)-Human methionine sulfoxide reductase B3 (MSRB3), nuclear gene encoding mitochondrial protein, transcript variant 2


  "NM_001031679" in other vectors (4)

Reconstitution Protocol

USD 300.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (4)
MSRB3 mouse monoclonal antibody, clone OTI2A2 (formerly 2A2)
    • 100 ul

USD 447.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "MSRB3"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol MSRB3
Synonyms DFNB74
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>OriGene sequence for NM_001031679.1 CACCGGCGGCGGCTGCCTGGCCTTTCCATGAGCCCGCGGCGGACCCTCCCGCGCCCCCTC
TCGCTCTGCCTCTCCCTCTGCCTCTGCCTCTGCCTGGCCGCGGCTCTGGGAAGTGCGCAG
TCCGAGTGACATCACTGCCTCTCTTCCTGTGCGCTGGCTTTGACATAAGCCAGATGGCCA
CCGTGGTTGGTAGGCGCCCAGGCTGCCTGGTACAGGAGTTGATGAAACAGAATAGGAAGA
CGTTTTATGGTCAGCTGTGGAAGCACAGTGAGACTGCAGCTTTGCTAACTCTTGCCCCTG
TTCTTTGCTTCTCGTTTTGTTGGTGAAGATATCACAGTGATGTCTGCATTCAACCTGCTG
CATTTGGTGACAAAGAGCCAGCCAGTAGCCCTTCGAGCCTGTGGGCTTCCCTCAGGGTCG
TGTAGGGATAAAAAGAACTGTAAGGTGGTCTTTTCCCAGCAGGAACTGAGGAAGCGGCTA
ACACCCCTGCAGTACCATGTCACTCAGGAGAAAGGGACCGAAAGTGCCTTTGAAGGAGAA
TACACACATCACAAAGATCCTGGAATATATAAATGTGTTGTTTGTGGAACTCCATTGTTT
AAGTCAGAAACCAAATTTGACTCCGGTTCAGGTTGGCCTTCATTCCACGATGTGATCAAT
TCTGAGGCAATCACATTCACAGATGACTTTTCCTATGGGATGCACAGGGTGGAAACAAGC
TGCTCTCAGTGTGGTGCTCACCTTGGGCACATTTTTGATGATGGGCCTCGTCCAACTGGG
AAAAGATACTGCATAAATTCGGCTGCCTTGTCTTTTACACCTGCGGATAGCAGTGGCACC
GCCGAGGGAGGCAGTGGGGTCGCCAGCCCGGCCCAGGCAGACAAAGCGGAGCTCTAGAGT
AATGGAGAGTGATGGAAACAAAGTGTACTTAATGCACAGCTTATTAAAAAAATCAAAATT
GTTAAAAAAAAAAAAAAAA
Restriction Sites Please inquire     
ACCN NM_001031679
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001031679.1, NP_001026849.1
RefSeq Size 4369 bp
RefSeq ORF 558 bp
Locus ID 253827
UniProt ID Q8IXL7
Cytogenetics 12q14.3
Gene Summary The protein encoded by this gene catalyzes the reduction of methionine sulfoxide to methionine. This enzyme acts as a monomer and requires zinc as a cofactor. Several transcript variants encoding two different isoforms have been found for this gene. One of the isoforms localizes to mitochondria while the other localizes to endoplasmic reticula. [provided by RefSeq, Jul 2010]
Transcript Variant: This variant (2) differs in the 5' UTR and coding sequence compared to variant 1. The resulting isoform (2) has a shorter and distinct N-terminus compared to isoform 1. Variants 2, 3, and 4 all encode isoform 2. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.