HLA-DPB1 (NM_002121) Human Untagged Clone

CAT#: SC320914

HLA (untagged)-Human major histocompatibility complex, class II, DP beta 1 (HLA-DPB1)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: HLA-DPB1
• Synonyms: DPB1; HLA-DP; HLA-DP1B; HLA-DPB
• Vector: pCMV6-AC
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >OriGene sequence for NM_002121.4 GCTCTTTTCATTTTGCCATCCTTTTCCAGCTCCATGATGGTTCTGCAGGTTTCTGCGGCC
  CCCCGGACAGTGGCTCTGACGGCGTTACTGATGGTGCTGCTCACATCTGTGGTCCAGGGC
  AGGGCCACTCCAGAGAATTACGTGCACCAGTTACGGCAGGAATGCTACGCGTTTAATGGG
  ACACAGCGCTTCCTGGAGAGATACATCTACAACCGGGAGGAGTTCGTGCGCTTCGACAGC
  GACGTGGGGGAGTTCCGGGCGGTGACGGAGCTGGGGCGGCCTGATGAGGACTACTGGAAC
  AGCCAGAAGGACATCCTGGAGGAGGAGCGGGCAGTGCCGGACAGGATGTGCAGACACAAC
  TACGAGCTGGACGAGGCCGTGACCCTGCAGCGCCGAGTCCAGCCTAGGGTGAATGTTTCC
  CCCTCCAAGAAGGGGCCCTTGCAGCACCACAACCTGCTTGTCTGCCACGTGACGGATTTC
  TACCCAGGCAGCATTCAAGTCCGATGGTTCCTGAATGGACAGGAGGAAACAGCTGGGGTC
  GTGTCCACCAACCTGATCCGTAATGGAGACTGGACCTTCCAGATCCTGGTGATGCTGGAA
  ATGACCCCCCAGCAGGGAGATGTCTACACCTGCCAAGTGGAGCACACCAGCCTGGATAGT
  CCTGTCACCGTGGAGTGGAAGGCACAGTCTGATTCTGCCCGGAGTAAGACATTGACGGGA
  GCTGGGGGCTTCGTGCTGGGGCTCATCATCTGTGGAGTGGGCATCTTCATGCACAGGAGG
  AGCAAGAAAGTTCAACGAGGATCTGCATAAACAGGGTTCCTGAGCTCACTGAAAAGACTA
  TTGTGCCTTAGGAAAAGCATTTGCTGTGTTTCGTTAGCATCTGGCTCCAGGACAGACCTT
  CAACTTCCAAATTGGATACTGCTGCCAAGAAGTTGCTCTGAAGTCAGTTTCTATCATTCT
  GCTCTTTGATTCAAAGCACTGTTTCTCTCACTGGGCCTCCAACCATGTTCCCTTCTTCTT
  AGCACCACAAATAATCAAAACCCAACATGAAAAAAAAAAAAAAAAAAAAA
• Restriction Sites: Please inquire
• ACCN: NM_002121
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_002121.4, NP_002112.3
• RefSeq Size: 1501 bp
• RefSeq ORF: 777 bp
• Locus ID: 3115
• UniProt ID: P04440
• Cytogenetics: 6p21.32
• Domains: MHC_II_beta, ig, IGc1
• Protein Families: Transmembrane
• Protein Pathways: Allograft rejection, Antigen processing and presentation, Asthma, Autoimmune thyroid disease, Cell adhesion molecules (CAMs), Graft-versus-host disease, Systemic lupus erythematosus, Type I diabetes mellitus, Viral myocarditis
• Gene Summary: HLA-DPB belongs to the HLA class II beta chain paralogues. This class II molecule is a heterodimer consisting of an alpha (DPA) and a beta chain (DPB), both anchored in the membrane. It plays a central role in the immune system by presenting peptides derived from extracellular proteins. Class II molecules are expressed in antigen presenting cells (APC: B lymphocytes, dendritic cells, macrophages). The beta chain is approximately 26-28 kDa and its gene contains 6 exons. Exon one encodes the leader peptide, exons 2 and 3 encode the two extracellular domains, exon 4 encodes the transmembrane domain and exon 5 encodes the cytoplasmic tail. Within the DP molecule both the alpha chain and the beta chain contain the polymorphisms specifying the peptide binding specificities, resulting in up to 4 different molecules. [provided by RefSeq, Jul 2008]