Activin A Receptor Type IC (ACVR1C) (NM_001111031) Human Untagged Clone
CAT#: SC317202
ACVR1C (untagged)-Human activin A receptor, type IC (ACVR1C), transcript variant 2
"NM_001111031" in other vectors (6)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | ACVR1C |
Synonyms | ACVRLK7; ALK7 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001111031, the custom clone sequence may differ by one or more nucleotides
ATGCTAACCAATGGAAAAGAGCAGGTGATCAAATCCTGTGTCTCCCTTCCAGAACTGAAT GCTCAAGTCTTCTGTCATAGTTCCAACAATGTTACCAAAACCGAATGCTGCTTCACAGAT TTTTGCAACAACATAACACTGCACCTTCCAACAGCATCACCAAATGCCCCAAAACTTGGA CCCATGGAGCTGGCCATCATTATTACTGTGCCTGTTTGCCTCCTGTCCATAGCTGCGATG CTGACAGTATGGGCATGCCAGGGTCGACAGTGCTCCTACAGGAAGAAAAAGAGACCAAAT GTGGAGGAACCACTCTCTGAGTGCAATCTGGTAAATGCTGGAAAAACTCTGAAAGATCTG ATTTATGATGTGACCGCCTCTGGATCTGGCTCTGGTCTACCTCTGTTGGTTCAAAGGACA ATTGCAAGGACGATTGTGCTTCAGGAAATAGTAGGAAAAGGTAGATTTGGTGAGGTGTGG CATGGAAGATGGTGTGGGGAAGATGTGGCTGTGAAAATATTCTCCTCCAGAGATGAAAGA TCTTGGTTTCGTGAGGCAGAAATTTACCAGACGGTCATGCTGCGACATGAAAACATCCTT GGTTTCATTGCTGCTGACAACAAAGATAATGGAACTTGGACTCAACTTTGGCTGGTATCT GAATATCATGAACAGGGCTCCTTATATGACTATTTGAATAGAAATATAGTGACCGTGGCT GGAATGATCAAGCTGGCGCTCTCAATTGCTAGTGGTCTGGCACACCTTCATATGGAGATT GTTGGTACACAAGGTAAACCTGCTATTGCTCATCGAGACATAAAATCAAAGAATATCTTA GTGAAAAAGTGTGAAACTTGTGCCATAGCGGACTTAGGGTTGGCTGTGAAGCATGATTCA ATACTGAACACTATCGACATACCTCAGAATCCTAAAGTGGGAACCAAGAGGTATATGGCT CCTGAAATGCTTGATGATACAATGAATGTGAATATCTTTGAGTCCTTCAAACGAGCTGAC ATCTATTCTGTTGGTCTGGTTTACTGGGAAATAGCCCGGAGGTGTTCAGTCGGAGGAATT GTTGAGGAGTACCAATTGCCTTATTATGACATGGTGCCTTCAGATCCCTCGATAGAGGAA ATGAGAAAGGTTGTTTGTGACCAGAAGTTTCGACCAAGTATCCCAAACCAGTGGCAAAGT TGTGAAGCACTCCGAGTCATGGGGAGAATAATGCGTGAGTGTTGGTATGCCAACGGAGCG GCCCGCCTAACTGCTCTTCGTATTAAGAAGACTATATCTCAACTTTGTGTCAAAGAAGAC TGCAAAGCC |
Restriction Sites | Please inquire |
ACCN | NM_001111031 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001111031.1, NP_001104501.1 |
RefSeq Size | 8777 bp |
RefSeq ORF | 1332 bp |
Locus ID | 130399 |
UniProt ID | Q8NER5 |
Cytogenetics | 2q24.1 |
Protein Families | Druggable Genome, Protein Kinase, Transmembrane |
Protein Pathways | Adherens junction, Chronic myeloid leukemia, Colorectal cancer, Endocytosis, MAPK signaling pathway, Pancreatic cancer, Pathways in cancer, TGF-beta signaling pathway |
Gene Summary | ACVR1C is a type I receptor for the TGFB (see MIM 190180) family of signaling molecules. Upon ligand binding, type I receptors phosphorylate cytoplasmic SMAD transcription factors, which then translocate to the nucleus and interact directly with DNA or in complex with other transcription factors (Bondestam et al., 2001 [PubMed 12063393]).[supplied by OMIM, Mar 2008] Transcript Variant: This variant (2) contains a distinct 5' UTR and lacks an in-frame portion of the 5' coding region, compared to variant 1. The resulting isoform (2), also known as tALK7, has a shorter N-terminus when compared to isoform 1, and lacks part of the activin receptor-binding domain. Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript was available for the full length of the gene. The extent of this transcript is supported by transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC225725 | ACVR1C (Myc-DDK-tagged)-Human activin A receptor, type IC (ACVR1C), transcript variant 2 |
USD 503.00 |
|
RC225725L1 | Lenti-ORF clone of ACVR1C (Myc-DDK-tagged)-Human activin A receptor, type IC (ACVR1C), transcript variant 2 |
USD 803.00 |
|
RC225725L2 | Lenti-ORF clone of ACVR1C (mGFP-tagged)-Human activin A receptor, type IC (ACVR1C), transcript variant 2 |
USD 803.00 |
|
RC225725L3 | Lenti-ORF clone of ACVR1C (Myc-DDK-tagged)-Human activin A receptor, type IC (ACVR1C), transcript variant 2 |
USD 803.00 |
|
RC225725L4 | Lenti-ORF clone of ACVR1C (mGFP-tagged)-Human activin A receptor, type IC (ACVR1C), transcript variant 2 |
USD 803.00 |
|
RG225725 | ACVR1C (tGFP-tagged) - Human activin A receptor, type IC (ACVR1C), transcript variant 2 |
USD 703.00 |
{0} Product Review(s)
Be the first one to submit a review