Activin A Receptor Type IC (ACVR1C) (NM_001111032) Human Untagged Clone

CAT#: SC317196

ACVR1C (untagged)-Human activin A receptor, type IC (ACVR1C), transcript variant 3


  "NM_001111032" in other vectors (4)

Reconstitution Protocol

USD 503.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
ACVR1C Rabbit polyclonal Antibody
    • 100 ul

USD 365.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Activin A Receptor Type IC"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol Activin A Receptor Type IC
Synonyms ACVRLK7; ALK7
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC317196 representing NM_001111032.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGACCCGGGCGCTCTGCTCAGCGCTCCGCCAGGCTCTCCTGCTGCTCGCAGCGGCCGCCGAGCTCTCG
CCAGGACTGAAGTGTGTATGTCTTTTGTGTGATTCTTCAAACTTTACCTGCCAAACAGAAGGAGCATGT
TGGGCATCAGTCATGCTAACCAATGGAAAAGAGCAGGTGATCAAATCCTGTGTCTCCCTTCCAGAACTG
AATGCTCAAGTCTTCTGTCATAGTTCCAACAATGTTACCAAAACCGAATGCTGCTTCACAGATTTTTGC
AACAACATAACACTGCACCTTCCAACAGGTCTACCTCTGTTGGTTCAAAGGACAATTGCAAGGACGATT
GTGCTTCAGGAAATAGTAGGAAAAGGTAGATTTGGTGAGGTGTGGCATGGAAGATGGTGTGGGGAAGAT
GTGGCTGTGAAAATATTCTCCTCCAGAGATGAAAGATCTTGGTTTCGTGAGGCAGAAATTTACCAGACG
GTCATGCTGCGACATGAAAACATCCTTGGTTTCATTGCTGCTGACAACAAAGATAATGGAACTTGGACT
CAACTTTGGCTGGTATCTGAATATCATGAACAGGGCTCCTTATATGACTATTTGAATAGAAATATAGTG
ACCGTGGCTGGAATGATCAAGCTGGCGCTCTCAATTGCTAGTGGTCTGGCACACCTTCATATGGAGATT
GTTGGTACACAAGGTAAACCTGCTATTGCTCATCGAGACATAAAATCAAAGAATATCTTAGTGAAAAAG
TGTGAAACTTGTGCCATAGCGGACTTAGGGTTGGCTGTGAAGCATGATTCAATACTGAACACTATCGAC
ATACCTCAGAATCCTAAAGTGGGAACCAAGAGGTATATGGCTCCTGAAATGCTTGATGATACAATGAAT
GTGAATATCTTTGAGTCCTTCAAACGAGCTGACATCTATTCTGTTGGTCTGGTTTACTGGGAAATAGCC
CGGAGGTGTTCAGTCGGAGGAATTGTTGAGGAGTACCAATTGCCTTATTATGACATGGTGCCTTCAGAT
CCCTCGATAGAGGAAATGAGAAAGGTTGTTTGTGACCAGAAGTTTCGACCAAGTATCCCAAACCAGTGG
CAAAGTTGTGAAGCACTCCGAGTCATGGGGAGAATAATGCGTGAGTGTTGGTATGCCAACGGAGCGGCC
CGCCTAACTGCTCTTCGTATTAAGAAGACTATATCTCAACTTTGTGTCAAAGAAGACTGCAAAGCCTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001111032
Insert Size 1242 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001111032.1
RefSeq Size 8652 bp
RefSeq ORF 1242 bp
Locus ID 130399
UniProt ID Q8NER5
Cytogenetics 2q24.1
Protein Families Druggable Genome, Protein Kinase, Transmembrane
Protein Pathways Adherens junction, Chronic myeloid leukemia, Colorectal cancer, Endocytosis, MAPK signaling pathway, Pancreatic cancer, Pathways in cancer, TGF-beta signaling pathway
MW 46.4 kDa
Gene Summary ACVR1C is a type I receptor for the TGFB (see MIM 190180) family of signaling molecules. Upon ligand binding, type I receptors phosphorylate cytoplasmic SMAD transcription factors, which then translocate to the nucleus and interact directly with DNA or in complex with other transcription factors (Bondestam et al., 2001 [PubMed 12063393]).[supplied by OMIM, Mar 2008]
Transcript Variant: This variant (3) lacks an alternate in-frame exon in the coding region, compared to variant 1. The resulting isoform (3), also known as sALK7a, lacks the transmembrane and GS domains, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript was available for the full length of the gene. The extent of this transcript is supported by transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.