C1orf61 (NM_006365) Human Untagged Clone
CAT#: SC310661
C1orf61 (untagged)-Human chromosome 1 open reading frame 61 (C1orf61)
"NM_006365" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | C1orf61 |
Synonyms | CROC4 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC310661 representing NM_006365.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGTTCCTGACTGAGGATCTCATAACATTTAACTTGAGGAACTTCCTCCTTTTCCAGCTTTGGGAGTCA AGCTTCTCACCTGGGGCGGGTGGGTTCTGCACCACCCTCCCACCCTCCTTCCTCCGTGTGGACGATAGA GCCACATCCAGCACCACGGACAGCTCCCGGGCGCCTTCATCTCCTCGTCCTCCAGGCAGCACAAGCCAT TGTGGAATCTCCACCAGGTGTACAGAACGGTGCCTCTGCGTCCTGCCACTCAGGACCTCTCAAGTCCCC GATGTGATGGCTCCTCAGCATGATCAGGAGAAATTCCATGATCTTGCTTATTCCTGTCTTGGGAAGTCC TTCTCCATGTCTAACCAAGATCTATATGGCTATAGCACCAGCTCTTTGGCTCTTGGCTTGGCATGGCTA AGTTGGGAGACCAAAAAGAAGAATGTACTTCATCTGGTTGGGCTGGATTCCCTCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_006365 |
Insert Size | 471 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_006365.2 |
RefSeq Size | 1054 bp |
RefSeq ORF | 471 bp |
Locus ID | 10485 |
UniProt ID | Q13536 |
Cytogenetics | 1q22 |
Protein Families | Transcription Factors |
MW | 17.2 kDa |
Gene Summary | May play a role in FOS signaling pathways involved in development and remodeling of neurons. Promotes transcription of the FOS promoter.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) encodes the longest isoform (1). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC214855 | C1orf61 (Myc-DDK-tagged)-Human chromosome 1 open reading frame 61 (C1orf61) |
USD 150.00 |
|
RC214855L3 | Lenti ORF clone of Human chromosome 1 open reading frame 61 (C1orf61), Myc-DDK-tagged |
USD 450.00 |
|
RC214855L4 | Lenti ORF clone of Human chromosome 1 open reading frame 61 (C1orf61), mGFP tagged |
USD 450.00 |
|
RG214855 | C1orf61 (tGFP-tagged) - Human chromosome 1 open reading frame 61 (C1orf61) |
USD 350.00 |
{0} Product Review(s)
Be the first one to submit a review