Chk2 (CHEK2) (NM_145862) Human Untagged Clone

CAT#: SC309135

CHEK2 (untagged)-Human CHK2 checkpoint homolog (S. pombe) (CHEK2), transcript variant 2


  "NM_145862" in other vectors (6)

Reconstitution Protocol

USD 527.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
CHEK2 (CHK2) mouse monoclonal antibody, clone OTI5C4 (formerly 5C4)
    • 100 ul

USD 447.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Chk2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol Chk2
Synonyms CDS1; CHK2; hCds1; HuCds1; LFS2; PP1425; RAD53
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC309135 representing NM_145862.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTCTCGGGAGTCGGATGTTGAGGCTCAGCAGTCTCATGGCAGCAGTGCCTGTTCACAGCCCCATGGC
AGCGTTACCCAGTCCCAAGGCTCCTCCTCACAGTCCCAGGGCATATCCAGCTCCTCTACCAGCACGATG
CCAAACTCCAGCCAGTCCTCTCACTCCAGCTCTGGGACACTGAGCTCCTTAGAGACAGTGTCCACTCAG
GAACTCTATTCTATTCCTGAGGACCAAGAACCTGAGGACCAAGAACCTGAGGAGCCTACCCCTGCCCCC
TGGGCTCGATTATGGGCCCTTCAGGATGGATTTGCCAATCTTGAATGTGTGAATGACAACTACTGGTTT
GGGAGGGACAAAAGCTGTGAATATTGCTTTGATGAACCACTGCTGAAAAGAACAGATAAATACCGAACA
TACAGCAAGAAACACTTTCGGATTTTCAGGGAAGTGGGTCCTAAAAACTCTTACATTGCATACATAGAA
GATCACAGTGGCAATGGAACCTTTGTAAATACAGAGCTTGTAGGGAAAGGAAAACGCCGTCCTTTGAAT
AACAATTCTGAAATTGCACTGTCACTAAGCAGAAATAAAGTTTTTGTCTTTTTTGATCTGACTGTAGAT
GATCAGTCAGTTTATCCTAAGGCATTAAGAGATGAATACATCATGTCAAAAACTCTTGGAAGTGGTGCC
TGTGGAGAGGTAAAGCTGGCTTTCGAGAGGAAAACATGTAAGAAAGTAGCCATAAAGATCATCAGCAAA
AGGAAGTTTGCTATTGGTTCAGCAAGAGAGGCAGACCCAGCTCTCAATGTTGAAACAGAAATAGAAATT
TTGAAAAAGCTAAATCATCCTTGCATCATCAAGATTAAAAACTTTTTTGATGCAGAAGATTATTATATT
GTTTTGGAATTGATGGAAGGGGGAGAGCTGTTTGACAAAGTGGTGGGGAATAAACGCCTGAAAGAAGCT
ACCTGCAAGCTCTATTTTTACCAGATGCTCTTGGCTGTGCAGATTACTGATTTTGGGCACTCCAAGATT
TTGGGAGAGACCTCTCTCATGAGAACCTTATGTGGAACCCCCACCTACTTGGCGCCTGAAGTTCTTGTT
TCTGTTGGGACTGCTGGGTATAACCGTGCTGTGGACTGCTGGAGTTTAGGAGTTATTCTTTTTATCTGC
CTTAGTGGGTATCCACCTTTCTCTGAGCATAGGACTCAAGTGTCACTGAAGGATCAGATCACCAGTGGA
AAATACAACTTCATTCCTGAAGTCTGGGCAGAAGTCTCAGAGAAAGCTCTGGACCTTGTCAAGAAGTTG
TTGGTAGTGGATCCAAAGGCACGTTTTACGACAGAAGAAGCCTTAAGACACCCGTGGCTTCAGGATGAA
GACATGAAGAGAAAGTTTCAAGATCTTCTGTCTGAGGAAAATGAATCCACAGCTCTACCCCAGGTTCTA
GCCCAGCCTTCTACTAGTCGAAAGCGGCCCCGTGAAGGGGAAGCCGAGGGTGCCGAGACCACAAAGCGC
CCAGCTGTGTGTGCTGCTGTGTTGTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_145862
Insert Size 1545 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_145862.2
RefSeq Size 1775 bp
RefSeq ORF 1545 bp
Locus ID 11200
UniProt ID O96017
Cytogenetics 22q12.1
Protein Families Druggable Genome, Protein Kinase, Stem cell - Pluripotency
Protein Pathways Cell cycle, p53 signaling pathway
MW 57.5 kDa
Gene Summary In response to DNA damage and replication blocks, cell cycle progression is halted through the control of critical cell cycle regulators. The protein encoded by this gene is a cell cycle checkpoint regulator and putative tumor suppressor. It contains a forkhead-associated protein interaction domain essential for activation in response to DNA damage and is rapidly phosphorylated in response to replication blocks and DNA damage. When activated, the encoded protein is known to inhibit CDC25C phosphatase, preventing entry into mitosis, and has been shown to stabilize the tumor suppressor protein p53, leading to cell cycle arrest in G1. In addition, this protein interacts with and phosphorylates BRCA1, allowing BRCA1 to restore survival after DNA damage. Mutations in this gene have been linked with Li-Fraumeni syndrome, a highly penetrant familial cancer phenotype usually associated with inherited mutations in TP53. Also, mutations in this gene are thought to confer a predisposition to sarcomas, breast cancer, and brain tumors. This nuclear protein is a member of the CDS1 subfamily of serine/threonine protein kinases. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
Transcript Variant: This variant (2) lacks an alternate in-frame exon compared to variant 1. The resulting isoform (b) has the same N- and C-termini but is shorter compared to isoform a.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.