CCL27 (NM_006664) Human Untagged Clone

CAT#: SC303807

CCL27 (untagged)-Human chemokine (C-C motif) ligand 27 (CCL27)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CCL27
• Synonyms: ALP; CTACK; CTAK; ESKINE; ILC; PESKY; SCYA27
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC303807 representing NM_006664.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGAAGGGGCCCCCAACCTTCTGCAGCCTCCTGCTGCTGTCATTGCTCCTGAGCCCAGACCCTACAGCA
  GCATTCCTACTGCCACCCAGCACTGCCTGCTGTACTCAGCTCTACCGAAAGCCACTCTCAGACAAGCTA
  CTGAGGAAGGTCATCCAGGTGGAACTGCAGGAGGCTGACGGGGACTGTCACCTCCAGGCTTTCGTGCTT
  CACCTGGCTCAACGCAGCATCTGCATCCACCCCCAGAACCCCAGCCTGTCACAGTGGTTTGAGCACCAA
  GAGAGAAAGCTCCATGGGACTCTGCCCAAGCTGAATTTTGGGATGCTAAGGAAAATGGGCTGA
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_006664
• Insert Size: 339 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_006664.3
• RefSeq Size: 475 bp
• RefSeq ORF: 339 bp
• Locus ID: 10850
• UniProt ID: Q9Y4X3
• Cytogenetics: 9p13.3
• Protein Families: Druggable Genome
• Protein Pathways: Chemokine signaling pathway, Cytokine-cytokine receptor interaction
• MW: 12.6 kDa
• Gene Summary: This gene is one of several CC cytokine genes clustered on the p-arm of chromosome 9. Cytokines are a family of secreted proteins involved in immunoregulatory and inflammatory processes. The CC cytokines are proteins characterized by two adjacent cysteines. The protein encoded by this gene is chemotactic for skin-associated memory T lymphocytes. This cytokine may also play a role in mediating homing of lymphocytes to cutaneous sites. It specifically binds to chemokine receptor 10 (CCR10). Studies of a similar murine protein indicate that these protein-receptor interactions have a pivotal role in T cell-mediated skin inflammation. [provided by RefSeq, Sep 2014]